ID: 1012403052

View in Genome Browser
Species Human (GRCh38)
Location 6:98860460-98860482
Sequence ATGGCGTACATATATGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012403052_1012403057 3 Left 1012403052 6:98860460-98860482 CCTTTCCCATATATGTACGCCAT No data
Right 1012403057 6:98860486-98860508 AGTCAAGTGTTCAGTTTTATGGG No data
1012403052_1012403058 16 Left 1012403052 6:98860460-98860482 CCTTTCCCATATATGTACGCCAT No data
Right 1012403058 6:98860499-98860521 GTTTTATGGGAATGTAAATCTGG No data
1012403052_1012403056 2 Left 1012403052 6:98860460-98860482 CCTTTCCCATATATGTACGCCAT No data
Right 1012403056 6:98860485-98860507 AAGTCAAGTGTTCAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012403052 Original CRISPR ATGGCGTACATATATGGGAA AGG (reversed) Intergenic
No off target data available for this crispr