ID: 1012403055

View in Genome Browser
Species Human (GRCh38)
Location 6:98860479-98860501
Sequence AACTGAACACTTGACTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012403055_1012403060 27 Left 1012403055 6:98860479-98860501 CCATGAAAGTCAAGTGTTCAGTT No data
Right 1012403060 6:98860529-98860551 CACTACATTGAATTCATAGTTGG No data
1012403055_1012403058 -3 Left 1012403055 6:98860479-98860501 CCATGAAAGTCAAGTGTTCAGTT No data
Right 1012403058 6:98860499-98860521 GTTTTATGGGAATGTAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012403055 Original CRISPR AACTGAACACTTGACTTTCA TGG (reversed) Intergenic
No off target data available for this crispr