ID: 1012403057

View in Genome Browser
Species Human (GRCh38)
Location 6:98860486-98860508
Sequence AGTCAAGTGTTCAGTTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012403049_1012403057 29 Left 1012403049 6:98860434-98860456 CCTGAATGTTATTAGCCATCCAT No data
Right 1012403057 6:98860486-98860508 AGTCAAGTGTTCAGTTTTATGGG No data
1012403050_1012403057 14 Left 1012403050 6:98860449-98860471 CCATCCATACACCTTTCCCATAT No data
Right 1012403057 6:98860486-98860508 AGTCAAGTGTTCAGTTTTATGGG No data
1012403054_1012403057 -3 Left 1012403054 6:98860466-98860488 CCATATATGTACGCCATGAAAGT No data
Right 1012403057 6:98860486-98860508 AGTCAAGTGTTCAGTTTTATGGG No data
1012403052_1012403057 3 Left 1012403052 6:98860460-98860482 CCTTTCCCATATATGTACGCCAT No data
Right 1012403057 6:98860486-98860508 AGTCAAGTGTTCAGTTTTATGGG No data
1012403051_1012403057 10 Left 1012403051 6:98860453-98860475 CCATACACCTTTCCCATATATGT No data
Right 1012403057 6:98860486-98860508 AGTCAAGTGTTCAGTTTTATGGG No data
1012403053_1012403057 -2 Left 1012403053 6:98860465-98860487 CCCATATATGTACGCCATGAAAG No data
Right 1012403057 6:98860486-98860508 AGTCAAGTGTTCAGTTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012403057 Original CRISPR AGTCAAGTGTTCAGTTTTAT GGG Intergenic
No off target data available for this crispr