ID: 1012404467

View in Genome Browser
Species Human (GRCh38)
Location 6:98879336-98879358
Sequence CCTAAACCTACATTGTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012404459_1012404467 22 Left 1012404459 6:98879291-98879313 CCTACTAAGTGAATGCAAGGCAG 0: 1
1: 0
2: 2
3: 6
4: 83
Right 1012404467 6:98879336-98879358 CCTAAACCTACATTGTTTTAGGG 0: 1
1: 0
2: 2
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012404467 Original CRISPR CCTAAACCTACATTGTTTTA GGG Intronic
904709002 1:32414355-32414377 TCAATACCTACATTCTTTTAAGG + Intergenic
906071571 1:43020621-43020643 CCTAAAGCTACACTGATTCATGG - Intergenic
908596210 1:65691462-65691484 GCTCAAGCTACTTTGTTTTATGG + Intergenic
912052556 1:105548388-105548410 CCCCAAGCTACATTGTTTTGGGG - Intergenic
912063211 1:105700346-105700368 CCTCAACCTCCCTTGTTTTATGG + Intergenic
912094820 1:106125954-106125976 CCTAAACCTACAATGGCCTATGG - Intergenic
912347051 1:108973361-108973383 CCTAAAATTACATTGTTTATTGG + Intronic
912790975 1:112650409-112650431 CCTAATTATACATTGATTTAAGG + Intronic
914079373 1:144392573-144392595 CCTAACCCTATATTGTTCAAGGG - Intergenic
914099806 1:144573929-144573951 CCTAACCCTATATTGTTCAAGGG + Intergenic
915339574 1:155169052-155169074 CGTATACCTACACTGTTTCACGG - Intergenic
917092970 1:171372485-171372507 CCTAATCCTACATTCTTTATTGG - Intergenic
918263091 1:182814203-182814225 CCTAAACCTACCAGGTTCTAAGG - Intronic
920163496 1:204018231-204018253 CATAAATCTATATTGTTTTAAGG - Intergenic
920900728 1:210107837-210107859 CCTAAACCTAAATTGCTATTAGG - Intronic
921128291 1:212197216-212197238 CCCCAACCTGCATTGTTGTAGGG + Intergenic
1064454104 10:15470681-15470703 CCCAAACCTATATTGTTCTCAGG + Intergenic
1065914384 10:30340937-30340959 TCTTAACTAACATTGTTTTAAGG - Intronic
1068228966 10:54144753-54144775 ACTTAAATTACATTGTTTTAAGG - Intronic
1069239560 10:66123182-66123204 CCTGAACCTCCATTGTTTCTAGG - Intronic
1071671377 10:87612228-87612250 CCTATACCTACATTGTATCTAGG + Intergenic
1073095638 10:100978104-100978126 TCCAAACATACATTGTTTTGAGG + Intronic
1073164137 10:101429035-101429057 TCTACAACTATATTGTTTTAAGG + Intronic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1086186544 11:84024114-84024136 CCCAACCCTACATTGTTTAAGGG + Intronic
1092788155 12:12048525-12048547 CCTAACCCCACATTGTTCAAGGG - Intergenic
1093965356 12:25318618-25318640 CCCAAATCAACATTGTTTCATGG + Intergenic
1094081733 12:26544005-26544027 CCTAAACAAACAGTATTTTAAGG + Intronic
1095487298 12:42698614-42698636 CCTATACATACTTTGTCTTAAGG + Intergenic
1099751999 12:86786984-86787006 ACAAAACATACATTGTTTGATGG - Intronic
1105910906 13:24866092-24866114 CCTTTAGCTATATTGTTTTAAGG - Intronic
1107367280 13:39696286-39696308 CTTAAACTTACATTGTAGTAGGG + Intronic
1107370956 13:39746898-39746920 CATACACATACATTATTTTAGGG - Intronic
1111428247 13:88118398-88118420 CCTACACCTCTTTTGTTTTATGG - Intergenic
1126337809 15:47605849-47605871 TCTAAACCTCCATTGTTTAGGGG + Intronic
1126678641 15:51183438-51183460 CGTGAATCTACCTTGTTTTATGG - Intergenic
1132046651 15:98568421-98568443 CATGCACCTACATTGTTTTATGG - Intergenic
1142530187 17:574414-574436 CCAAAACCTACCTGGTTTAAAGG - Intronic
1144318346 17:14087021-14087043 CCTTAACCTACTTTGTTTCATGG + Intronic
1148983489 17:51599769-51599791 CCTATACCTCCATTGTTTCTTGG + Intergenic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1160358340 18:78247516-78247538 CCTAAACCTCATTTGTTTAATGG - Intergenic
1164878668 19:31712358-31712380 CCCATACCTAAATTATTTTAGGG + Intergenic
1164901601 19:31930845-31930867 ACTGCACCTTCATTGTTTTAAGG + Intergenic
926481463 2:13401371-13401393 CATGAATCTACATTCTTTTAAGG - Intergenic
926912719 2:17866063-17866085 CCTAAAACTCTATTTTTTTATGG + Intergenic
927746009 2:25621755-25621777 CCTAAACCAACATTTTTAAATGG + Intronic
928058597 2:28085218-28085240 CATAAATGTAAATTGTTTTAAGG + Intronic
930731019 2:54727911-54727933 CCAAAACCTACATTATTATTAGG - Intronic
933430076 2:82165230-82165252 CCTAGACATACTTTTTTTTATGG + Intergenic
935164571 2:100559238-100559260 ACTAACACCACATTGTTTTAAGG + Intergenic
935169305 2:100598237-100598259 CCTAAACTTCCATTGGTTCATGG - Intergenic
936393729 2:112101439-112101461 CCTAACCCTACATTGTTCAAGGG - Intronic
936869487 2:117117879-117117901 CATACACCTACATTATTCTATGG - Intergenic
940642249 2:156357783-156357805 AATAAACCTAAATGGTTTTAGGG - Intergenic
941317084 2:164007070-164007092 CCTAAACCTACAGTTTTCTGTGG - Intergenic
941821083 2:169843900-169843922 TCCAAACCTAGATTGTTTCACGG - Intronic
941933357 2:170964323-170964345 CCTTAACCTACTTAGTTTTCAGG + Intronic
942483172 2:176411363-176411385 CCTAAACCTGCCTGGTTATAAGG + Intergenic
942866407 2:180680863-180680885 CCAAAACCTACAGTCTTTTTGGG + Intergenic
944499808 2:200347657-200347679 CCTAGCCCTACTTTGCTTTAGGG - Intronic
946499333 2:220229166-220229188 CCTAAACCCACATTGTTCAGGGG - Intergenic
946846235 2:223861187-223861209 CCTCACCCTACATTCTTTTTAGG + Intronic
948249500 2:236514293-236514315 CATAAACCTCCATAGTTTGAGGG - Intergenic
1174721889 20:52821624-52821646 ACTCAACCTATATTATTTTATGG - Intergenic
1177515748 21:22148788-22148810 CCTAAACCTGCATTGTATCGTGG + Intergenic
1179662239 21:42883987-42884009 CATTAATCTACTTTGTTTTATGG + Intronic
1182814019 22:33142448-33142470 CCAAAAACAACAGTGTTTTAAGG - Intergenic
1184450824 22:44581855-44581877 TCTAAACATTCATTGTTTTAAGG + Intergenic
949161384 3:886946-886968 CCTAAGCATGCATTGATTTAAGG - Intergenic
949647680 3:6116259-6116281 CCTAATCCTGCATTGTTCAAAGG - Intergenic
951039520 3:17973585-17973607 CCTAAATCTGCAGTGATTTATGG + Intronic
957817106 3:85314950-85314972 AATAAACTTATATTGTTTTAAGG - Intronic
957954357 3:87164742-87164764 CCTAAACTTAGTTTGCTTTATGG + Intergenic
958117439 3:89238637-89238659 CCGAAACCTACATTGGTTACAGG - Intronic
958131275 3:89427719-89427741 CTTAAACCCACAATGTTTTCTGG + Intronic
959545894 3:107596110-107596132 TTTAAACCTATATTGTTTAAGGG + Intronic
959927734 3:111942959-111942981 CCCAACCCTGTATTGTTTTAGGG + Intronic
960304211 3:116041217-116041239 CCTGATCCTACATATTTTTAAGG + Intronic
960850969 3:122053363-122053385 CCTAAACATTTATTGTTTTAAGG + Intergenic
962044326 3:131739552-131739574 CCTATAGTCACATTGTTTTAAGG - Intronic
965018771 3:163198400-163198422 AATAAACCAAAATTGTTTTATGG - Intergenic
968878622 4:3287316-3287338 CCTAAACATACATTTTCTCAAGG + Intergenic
972011715 4:34190880-34190902 CCTAAACCTCCATTGTATTTTGG + Intergenic
972094605 4:35333729-35333751 CCTACACCCACATTGTTTCTTGG - Intergenic
972849613 4:43032668-43032690 ACCAAACCTCCATGGTTTTATGG + Intergenic
974124601 4:57680315-57680337 CCTAATTATACCTTGTTTTAAGG + Intergenic
974414574 4:61590612-61590634 CCAAAAAATACATAGTTTTATGG - Intronic
974630610 4:64482736-64482758 CTTTAACTTACCTTGTTTTATGG - Intergenic
977046406 4:92073090-92073112 CCTATACCTCCATTGTATTTTGG + Intergenic
978356441 4:107879803-107879825 CATAAAATTAAATTGTTTTAAGG + Intronic
978865113 4:113497784-113497806 CCTAGACTTACATTGTTTTATGG - Intronic
980841699 4:138269123-138269145 CCTAAAACTGCATTATTTTCTGG + Intergenic
981571758 4:146159201-146159223 CCCTAACCTGCATTGTTTGAGGG + Intergenic
981823408 4:148912547-148912569 CTTAGACTTACATTGTTTTAAGG - Intergenic
982798943 4:159678648-159678670 CTTAAAGCTACTTTGTTTTAAGG + Intergenic
984297832 4:177876237-177876259 CCTACACCTACCGTGTTTTAGGG - Intronic
986472883 5:8093641-8093663 CCTATACCTTCATTGTTTCTTGG - Intergenic
987617441 5:20294671-20294693 CCTAATCTTACCTTGTCTTAAGG + Intronic
988458651 5:31412109-31412131 CCTAAACCATACTTGTTTTATGG - Intronic
992154862 5:73945178-73945200 CCAGAACCTACATTGCTTTATGG - Intergenic
993553651 5:89307671-89307693 TGTTAACCTATATTGTTTTAAGG + Intergenic
994544342 5:101143970-101143992 TATAACCCTACATTGTTTTTAGG + Intergenic
994654057 5:102567248-102567270 TCTATACCTACCTTTTTTTACGG + Intergenic
994764628 5:103900656-103900678 CCTATACCTCCATTGTATTTGGG + Intergenic
995261036 5:110104718-110104740 CCTGATCCTACAGTGTTTCAAGG - Intergenic
995342733 5:111077667-111077689 CCTAATCCTCAATTCTTTTAGGG - Intronic
995690861 5:114824799-114824821 CCTATACCTTCATTGTATTTTGG - Intergenic
999774468 5:154801063-154801085 TCTAAACCTATCTTTTTTTAAGG - Intronic
1002296998 5:178237288-178237310 CCAAAATCGCCATTGTTTTAAGG + Intergenic
1004576016 6:16895784-16895806 CCCAAACCTGCATTGTTCAAGGG + Intergenic
1005069368 6:21850332-21850354 CCTACCCCCACATTGTTTAAGGG + Intergenic
1007249953 6:40488722-40488744 CCTATACCCACTGTGTTTTAGGG + Intronic
1007877820 6:45126324-45126346 ACTAAACCTACAATGTTTTTGGG - Intronic
1008229175 6:48962888-48962910 CTTAAAGCTACATTGTTATGTGG - Intergenic
1010303856 6:74293327-74293349 TCTAAATATACATTGCTTTATGG - Intergenic
1010698597 6:79010910-79010932 CCTAAATATAAATTGTTTTATGG - Intronic
1010849844 6:80760128-80760150 CATACACCTCCATTGATTTAGGG + Intergenic
1011167234 6:84462801-84462823 ACTAAACATAAAATGTTTTAAGG + Intergenic
1012404467 6:98879336-98879358 CCTAAACCTACATTGTTTTAGGG + Intronic
1013537220 6:111074399-111074421 CCCAATCTTACATTTTTTTATGG + Intergenic
1014567531 6:122968681-122968703 TTTAAACCTACAATGTTATATGG - Intergenic
1016291841 6:142535864-142535886 CCCAATTCTACCTTGTTTTAGGG - Intergenic
1018145316 6:160880926-160880948 CCTAAACCTGCAAAATTTTAAGG - Intergenic
1020235646 7:6353364-6353386 CCTAAACTTGCATTCTTCTAAGG - Intergenic
1022144829 7:27526845-27526867 CCCAAACTCACATTGTGTTAAGG + Intronic
1022515565 7:30972929-30972951 ACTAAACCCACATTGTTCAAGGG - Intronic
1025834739 7:65083783-65083805 CCAATAACTATATTGTTTTAAGG - Intergenic
1025904513 7:65773304-65773326 CCAATAACTATATTGTTTTAAGG - Intergenic
1028207319 7:88032446-88032468 CCTATACCTCCATTGTGTTTTGG + Intronic
1028361821 7:89976972-89976994 TTTAAAACTACTTTGTTTTAGGG + Intergenic
1030847172 7:114434351-114434373 CCTAAATTTAGATTGTTTTTTGG + Intronic
1033581903 7:142745804-142745826 ACTAAACCCACAGTATTTTAAGG - Intergenic
1033892293 7:146029467-146029489 CCGAAATCTACATTGGTTAATGG - Intergenic
1035556317 8:569658-569680 CAGAAGCCTACATTATTTTAAGG + Intergenic
1036073708 8:5471306-5471328 ACTAAGCCTACTCTGTTTTAAGG + Intergenic
1038808603 8:30817369-30817391 CCTAAAGCAACATTGCTGTAGGG - Intergenic
1043562113 8:81505504-81505526 CCAAAAAATACAATGTTTTAGGG - Intergenic
1045639745 8:104235157-104235179 ACTTAAAATACATTGTTTTATGG - Intronic
1045740545 8:105353504-105353526 ATTAAACCTACATAGTTTTTTGG - Intronic
1046347171 8:112945535-112945557 CTTAAACCTACACACTTTTAGGG - Intronic
1046830194 8:118737277-118737299 CCTAAACCTTAATTGTATTTAGG + Intergenic
1047824261 8:128556316-128556338 CTAAAACTAACATTGTTTTAGGG + Intergenic
1052179288 9:25505067-25505089 CCTAAACCACCATTGTATTTTGG - Intergenic
1052577709 9:30311635-30311657 CCTATGCCTACATTGTATTTTGG - Intergenic
1052900618 9:33791768-33791790 ACTAAACCTAAATTATTTTAAGG - Intronic
1055872018 9:80892056-80892078 GCAAAATATACATTGTTTTAGGG - Intergenic
1060163793 9:121391531-121391553 CCCAAACCCACTTTGTTTTTTGG - Intergenic
1185882259 X:3751870-3751892 CCTACATCTACATTGTTGAATGG - Intergenic
1186152360 X:6688815-6688837 CTCAAACCTAGATTGTTCTAGGG - Intergenic
1189356962 X:40317232-40317254 CCCAAACCTACGATGTTTTGAGG + Intergenic
1190033130 X:46993576-46993598 CCCAAAGGTACATTGCTTTATGG + Intronic
1192932310 X:75819983-75820005 CCTAAACTTATCTTTTTTTATGG - Intergenic
1193871503 X:86804672-86804694 CCTATACCCTCATTGTTTTTTGG - Intronic
1195542385 X:106077197-106077219 CATAAACCAAACTTGTTTTATGG - Intergenic
1197405907 X:126049807-126049829 CCTAAAATTACATTTTTTTATGG + Intergenic
1198892167 X:141410036-141410058 CATAACCCAACATTATTTTAGGG + Intergenic
1200390891 X:155945682-155945704 CCTTACCCTAGATGGTTTTAGGG - Intergenic
1201577207 Y:15473860-15473882 CCAGAAACTATATTGTTTTATGG + Intergenic