ID: 1012406794

View in Genome Browser
Species Human (GRCh38)
Location 6:98909892-98909914
Sequence TAGCTAAAGTTGCCACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012406794_1012406798 19 Left 1012406794 6:98909892-98909914 CCTTTATGTGGCAACTTTAGCTA 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1012406798 6:98909934-98909956 GCATTTTAACTGTAATATGTTGG 0: 1
1: 0
2: 0
3: 19
4: 244
1012406794_1012406796 -3 Left 1012406794 6:98909892-98909914 CCTTTATGTGGCAACTTTAGCTA 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1012406796 6:98909912-98909934 CTACTTCACAGGATGTGCCATGG No data
1012406794_1012406799 24 Left 1012406794 6:98909892-98909914 CCTTTATGTGGCAACTTTAGCTA 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1012406799 6:98909939-98909961 TTAACTGTAATATGTTGGAGAGG 0: 1
1: 0
2: 2
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012406794 Original CRISPR TAGCTAAAGTTGCCACATAA AGG (reversed) Intronic
901282502 1:8050081-8050103 CAGATAAAATTGCCAAATAATGG - Intergenic
904339202 1:29822867-29822889 TGGCTACAGATGCCACATACAGG + Intergenic
905082310 1:35334809-35334831 TAGCTCAAGATGACACAAAAAGG - Intronic
906974994 1:50560870-50560892 TAGCTGAAGTTGCTTCATCAAGG - Intronic
911604231 1:99884364-99884386 AAGCTGGAGTTGCCACAAAAGGG + Exonic
916632940 1:166636725-166636747 TAGCTATAGTTGCTAAATGAGGG + Intergenic
918704045 1:187639031-187639053 TAGATAAGGTAGGCACATAAGGG - Intergenic
919838088 1:201590401-201590423 TAGATAAAGCTGCCAAAAAAAGG - Intergenic
921483188 1:215687190-215687212 TAGCTAATGCTGTCACCTAATGG + Intronic
923204461 1:231744618-231744640 AACCAAAACTTGCCACATAAGGG + Intronic
923836011 1:237611204-237611226 TAGTTGAAGATGCCACATGATGG + Intronic
1063442395 10:6083532-6083554 TATCTTAAGCTGCCTCATAAGGG - Intergenic
1064634101 10:17346169-17346191 CAGCTAGAGCTGCCACCTAAAGG - Intronic
1069021007 10:63488715-63488737 TATCTTCAGTTGCCAAATAATGG - Intergenic
1069626691 10:69872401-69872423 TAGCTAAAGATGCCCCAGCAGGG - Intronic
1070991669 10:80738875-80738897 TAGATAAGGTGGGCACATAAGGG - Intergenic
1070992867 10:80747767-80747789 TAGATAAGGTGGGCACATAAGGG - Intergenic
1072442831 10:95471969-95471991 GAGCTAAAATTGCCACATCGGGG - Intronic
1077824002 11:5784283-5784305 CAGCTATAGGTGCCAGATAATGG + Intronic
1079669977 11:23156647-23156669 TAGCAAAATTTCCCAGATAAGGG + Intergenic
1079699831 11:23530945-23530967 TAGCTAAAATAGTCAAATAATGG - Intergenic
1080626664 11:34036656-34036678 AATCTAAAGTTACCACACAAGGG - Intergenic
1080937136 11:36875937-36875959 TTGCTAAAGTAACCACATAGAGG + Intergenic
1081192214 11:40117770-40117792 TTGCTCAAGGTGACACATAATGG - Intronic
1081778733 11:45695137-45695159 TAGATAAGGTGGGCACATAAGGG + Intergenic
1087809610 11:102596219-102596241 CAGCTTAAGTTGCCTCATTAGGG - Intronic
1090095264 11:123736648-123736670 TACCTAAGCTTTCCACATAATGG + Intronic
1092189429 12:6507598-6507620 TAGATAAGGTGGGCACATAAGGG + Intronic
1093199991 12:16174893-16174915 TAGCTAAAGTTGTCAGGAAATGG + Intergenic
1097062559 12:56296533-56296555 TTGCTACAGTTGCCTCATTACGG + Intronic
1099494777 12:83333793-83333815 TAAATGAAATTGCCACATAAAGG - Intergenic
1099740125 12:86624263-86624285 AATCTAAAGTTGACACATACAGG + Intronic
1102753138 12:115313683-115313705 TAGATAATTTTGCCTCATAAGGG + Intergenic
1104164247 12:126211632-126211654 TAGGTAAATTTCCCATATAATGG + Intergenic
1105999610 13:25708870-25708892 TAACTAAAGTTGCCAAATTTTGG + Intronic
1106052290 13:26203082-26203104 TGGCCCAAATTGCCACATAATGG - Intronic
1108258886 13:48637518-48637540 TAGCTAAAGTAGCAACACACAGG - Intergenic
1111169678 13:84509282-84509304 TAGCCACAATTGCCACAAAAAGG - Intergenic
1115143536 14:30200664-30200686 TAGCTAAAGTTGCCAATCAGAGG + Intergenic
1117356596 14:54929865-54929887 TAGCTACAAATGCCACATTAGGG + Intergenic
1117378077 14:55133899-55133921 TAGCTGAATTTGCCTTATAAAGG - Intronic
1118952176 14:70445063-70445085 TGGCTAAAGTTGCATAATAAGGG - Intergenic
1120315050 14:82881569-82881591 TAGGTAAAATTGGCACAGAATGG - Intergenic
1123899174 15:24859028-24859050 TAGATAAGGTGGGCACATAAGGG - Intronic
1127548782 15:60016534-60016556 TGGCTGAACTTGCCAAATAAGGG + Intronic
1128034525 15:64512312-64512334 TAGATATATTTGCCACATATAGG + Intronic
1138721213 16:59082557-59082579 TAGATAAAGTTGTCATATTAGGG + Intergenic
1138722955 16:59103301-59103323 TGGCTAATTTAGCCACATAAAGG + Intergenic
1140569261 16:76084083-76084105 TAGGTAAAGTTGAAACAAAAGGG + Intergenic
1151095736 17:71495927-71495949 TAGCTAAAGTACACACATATAGG - Intergenic
1151216589 17:72581334-72581356 TAGCAAAAGTTGACAAATGAAGG - Intergenic
1155798247 18:30067355-30067377 TTGCTAAAGTTGCTTCATAGAGG + Intergenic
1167630721 19:50625020-50625042 CAGCTAAAGTTGGCACAGCAGGG + Intronic
1167811707 19:51838964-51838986 TAATTAAAATTGCCACAGAAAGG + Intergenic
927014584 2:18945288-18945310 TAGATAAAGTTGACTAATAAAGG - Intergenic
932613356 2:73215895-73215917 TTCCTCAAGTTGCCACATGAGGG + Intronic
934546651 2:95223333-95223355 TAAAGAAAGTTGCTACATAATGG - Intronic
937813440 2:126223804-126223826 AAGCAAGAGTTTCCACATAACGG + Intergenic
939415593 2:141892918-141892940 TAGCTCAAATTATCACATAATGG - Intronic
947490704 2:230592138-230592160 TAGGTTAACTTGCCCCATAATGG - Intergenic
947747090 2:232513413-232513435 TTGCTAAGGTAGCCACACAAAGG - Intergenic
1172330386 20:34071890-34071912 TACCAAGAGTTGCCACATATTGG - Intronic
1172978040 20:38920902-38920924 TAGCTAAGGTTGGCTCATGAGGG - Exonic
949102684 3:164929-164951 AAGTTAAAGTTGTCACAAAATGG - Intergenic
951096543 3:18638361-18638383 TAGGTAAACTTGCCCCATAGAGG - Intergenic
957154154 3:76525814-76525836 CAGCTAAAGTTGCCATTAAAGGG + Intronic
960403611 3:117233307-117233329 TGGCAAAAGTTGCCACTTAGAGG + Intergenic
963442108 3:145354208-145354230 TAGATAAGGTAGACACATAAGGG + Intergenic
965744946 3:171914952-171914974 TACCTAAACATGCAACATAATGG + Intronic
969146850 4:5131348-5131370 GAGATAAAATTGCCACATGACGG - Intronic
970827078 4:20288967-20288989 TAGGTGAAGTTGCCAAAGAAAGG + Intronic
971866722 4:32181988-32182010 TAGGAAAAGTTGCCAGAAAAAGG - Intergenic
972030939 4:34457357-34457379 TAGCTAAAGTTATTAAATAAAGG - Intergenic
972160562 4:36221389-36221411 TAGGTAAAATTGGCACAGAAAGG + Intronic
974183765 4:58418474-58418496 TAGCAAAAGTTGTCACTTCAGGG - Intergenic
975322315 4:73022624-73022646 GAGATAAAGCTGGCACATAAAGG - Intergenic
976635218 4:87280744-87280766 AATCTGAAGTTGTCACATAAAGG + Intergenic
977271628 4:94924125-94924147 TAACTATAGTTGCCATATACGGG - Intronic
981610252 4:146586243-146586265 TAGCTAGGATTGCGACATAATGG - Intergenic
983709293 4:170694256-170694278 TAGATAAGGTGGGCACATAAGGG + Intergenic
986474798 5:8117596-8117618 TAGCTTATTTTGCCACAGAAGGG - Intergenic
988415623 5:30943417-30943439 TGGTTAAAATTGCCAGATAAGGG + Intergenic
991279691 5:64898105-64898127 TATAGAAAGTGGCCACATAATGG + Intronic
992042226 5:72847473-72847495 TAGCTTTAGTTGCCACATGGAGG + Intronic
996498612 5:124190612-124190634 TAGCTAATGTTGCTACTTAGTGG - Intergenic
998494617 5:142576974-142576996 TAGCTAAAGGTTCCACAGATAGG - Intergenic
999841911 5:155437005-155437027 AAGCTAATATTGCCACATGAAGG + Intergenic
1002121467 5:177007536-177007558 TAGCAAATGTTGACACATATAGG - Intronic
1004196474 6:13510747-13510769 TAGCTAGAGTATCCACACAAAGG + Intergenic
1004658899 6:17692121-17692143 TACCTAATGTTGCCACATGAGGG - Intronic
1005124880 6:22435283-22435305 TTGCTTAAGTTGCCACATGTTGG + Intergenic
1008426230 6:51360355-51360377 TTTTTAAAGTTGACACATAATGG + Intergenic
1009451774 6:63809814-63809836 TAGCAAAAGTTATCACAGAAAGG + Intronic
1011952872 6:92989486-92989508 TAGCTCAATTTGCCAACTAAAGG + Intergenic
1012030639 6:94057283-94057305 TTCCTAAAGTTGTCAAATAATGG + Intergenic
1012406794 6:98909892-98909914 TAGCTAAAGTTGCCACATAAAGG - Intronic
1014307864 6:119765038-119765060 TAGATAAGGTGGGCACATAAAGG + Intergenic
1015181719 6:130367735-130367757 TAACTATAGTTTCCACTTAATGG - Intronic
1015561383 6:134519899-134519921 TTGCTACAGTAGCCATATAAAGG + Intergenic
1017602054 6:156094315-156094337 GAGCTAGAGTTGCCAAAAAAAGG - Intergenic
1018447784 6:163874179-163874201 TAGCTAATCTTGCCACTTTAGGG + Intergenic
1018736824 6:166693112-166693134 TCGCTAAACTTGCCACCCAACGG - Intronic
1024813228 7:53237678-53237700 TAGATAAGGTGGGCACATAAGGG + Intergenic
1026487845 7:70836570-70836592 TAGATAAGGTTGGCACATAAGGG - Intergenic
1027857974 7:83537233-83537255 TAGCTCAAGCTACCACAGAATGG - Intronic
1030712216 7:112763140-112763162 TAGCTGATGTTGCCAAAAAATGG - Exonic
1031450712 7:121914701-121914723 TAGTTAAAGTAACAACATAATGG + Intronic
1035095462 7:156350990-156351012 TAGAGAAAATTGACACATAATGG - Intergenic
1037284061 8:17277457-17277479 TAGCTGTTGTTGCCACATGATGG - Intronic
1038784649 8:30600907-30600929 TGGCTAAGGTTGCCACCTAGTGG + Intronic
1040103239 8:43523379-43523401 TAGATAAAGTGGGCACATAAGGG + Intergenic
1043697542 8:83239705-83239727 TAGGTAAAGATGCAAGATAAAGG - Intergenic
1048175744 8:132150483-132150505 TGGCTAAAGTTGGCTAATAAGGG + Intronic
1048544916 8:135377779-135377801 TAGCTTAAGTTCCCACAGAAGGG + Intergenic
1048725404 8:137377662-137377684 TAGAGGAAGTTCCCACATAAAGG - Intergenic
1050762965 9:9096221-9096243 TAGCCACCGTTGCCACAAAATGG + Intronic
1056323334 9:85457223-85457245 TGGTTAAAGTTGGAACATAATGG - Intergenic
1189541430 X:41994984-41995006 TAGCTTAAGCTGTCACATTAAGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194262186 X:91710014-91710036 TAGGTAAATTTGCTACACAAAGG + Intergenic
1196568881 X:117242525-117242547 AAACTAAAGTGTCCACATAAAGG - Intergenic
1199936483 X:152579203-152579225 TAGGTAAAGGCGACACATAAAGG - Intergenic
1200580838 Y:4948802-4948824 TAGGTAAATTTGCTACACAAAGG + Intergenic
1201404854 Y:13639372-13639394 TATCTAATGTTGACACATCAAGG - Intergenic