ID: 1012411620

View in Genome Browser
Species Human (GRCh38)
Location 6:98964938-98964960
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012411620_1012411625 29 Left 1012411620 6:98964938-98964960 CCCTCAAAAGCTGGCATGAGATA No data
Right 1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012411620 Original CRISPR TATCTCATGCCAGCTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr