ID: 1012411622

View in Genome Browser
Species Human (GRCh38)
Location 6:98964963-98964985
Sequence GTTGTTTTGCTTGAAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012411622_1012411625 4 Left 1012411622 6:98964963-98964985 CCTCCAGCTTCAAGCAAAACAAC No data
Right 1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
1012411622_1012411626 22 Left 1012411622 6:98964963-98964985 CCTCCAGCTTCAAGCAAAACAAC No data
Right 1012411626 6:98965008-98965030 ATTGGAGAAGAGTTTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012411622 Original CRISPR GTTGTTTTGCTTGAAGCTGG AGG (reversed) Intergenic
No off target data available for this crispr