ID: 1012411624

View in Genome Browser
Species Human (GRCh38)
Location 6:98964990-98965012
Sequence CCAATCTGCAGTTGCTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012411624_1012411626 -5 Left 1012411624 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
Right 1012411626 6:98965008-98965030 ATTGGAGAAGAGTTTGATATAGG No data
1012411624_1012411627 4 Left 1012411624 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
Right 1012411627 6:98965017-98965039 GAGTTTGATATAGGAACCAAAGG No data
1012411624_1012411628 15 Left 1012411624 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
Right 1012411628 6:98965028-98965050 AGGAACCAAAGGCAACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012411624 Original CRISPR CCAATCTGCAGTTGCTAAAG TGG (reversed) Intergenic
No off target data available for this crispr