ID: 1012411625

View in Genome Browser
Species Human (GRCh38)
Location 6:98964990-98965012
Sequence CCACTTTAGCAACTGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012411622_1012411625 4 Left 1012411622 6:98964963-98964985 CCTCCAGCTTCAAGCAAAACAAC No data
Right 1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
1012411623_1012411625 1 Left 1012411623 6:98964966-98964988 CCAGCTTCAAGCAAAACAACTCT No data
Right 1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
1012411621_1012411625 28 Left 1012411621 6:98964939-98964961 CCTCAAAAGCTGGCATGAGATAT No data
Right 1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
1012411619_1012411625 30 Left 1012411619 6:98964937-98964959 CCCCTCAAAAGCTGGCATGAGAT No data
Right 1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
1012411620_1012411625 29 Left 1012411620 6:98964938-98964960 CCCTCAAAAGCTGGCATGAGATA No data
Right 1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012411625 Original CRISPR CCACTTTAGCAACTGCAGAT TGG Intergenic
No off target data available for this crispr