ID: 1012411627

View in Genome Browser
Species Human (GRCh38)
Location 6:98965017-98965039
Sequence GAGTTTGATATAGGAACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012411624_1012411627 4 Left 1012411624 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG No data
Right 1012411627 6:98965017-98965039 GAGTTTGATATAGGAACCAAAGG No data
1012411623_1012411627 28 Left 1012411623 6:98964966-98964988 CCAGCTTCAAGCAAAACAACTCT No data
Right 1012411627 6:98965017-98965039 GAGTTTGATATAGGAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012411627 Original CRISPR GAGTTTGATATAGGAACCAA AGG Intergenic
No off target data available for this crispr