ID: 1012412205

View in Genome Browser
Species Human (GRCh38)
Location 6:98971364-98971386
Sequence CAGGGCAAAGACTCTACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012412197_1012412205 12 Left 1012412197 6:98971329-98971351 CCAGAAAGAAAGAGCATTCCAGG No data
Right 1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG No data
1012412203_1012412205 -6 Left 1012412203 6:98971347-98971369 CCAGGCAGAGGGAAGAGCAGGGC No data
Right 1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012412205 Original CRISPR CAGGGCAAAGACTCTACTGT GGG Intergenic
No off target data available for this crispr