ID: 1012413236

View in Genome Browser
Species Human (GRCh38)
Location 6:98984174-98984196
Sequence AGGGCTTCAATATTTGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012413236_1012413240 2 Left 1012413236 6:98984174-98984196 CCAGATTCAAATATTGAAGCCCT No data
Right 1012413240 6:98984199-98984221 GCCCCAGTGTATTTGGAGATAGG No data
1012413236_1012413246 14 Left 1012413236 6:98984174-98984196 CCAGATTCAAATATTGAAGCCCT No data
Right 1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG No data
1012413236_1012413245 10 Left 1012413236 6:98984174-98984196 CCAGATTCAAATATTGAAGCCCT No data
Right 1012413245 6:98984207-98984229 GTATTTGGAGATAGGGCCTGTGG No data
1012413236_1012413242 3 Left 1012413236 6:98984174-98984196 CCAGATTCAAATATTGAAGCCCT No data
Right 1012413242 6:98984200-98984222 CCCCAGTGTATTTGGAGATAGGG No data
1012413236_1012413237 -5 Left 1012413236 6:98984174-98984196 CCAGATTCAAATATTGAAGCCCT No data
Right 1012413237 6:98984192-98984214 GCCCTAAGCCCCAGTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012413236 Original CRISPR AGGGCTTCAATATTTGAATC TGG (reversed) Intergenic
No off target data available for this crispr