ID: 1012413239

View in Genome Browser
Species Human (GRCh38)
Location 6:98984194-98984216
Sequence CTCCAAATACACTGGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012413239_1012413249 21 Left 1012413239 6:98984194-98984216 CCTAAGCCCCAGTGTATTTGGAG No data
Right 1012413249 6:98984238-98984260 TAATATTAAATGAGGTCAAAAGG No data
1012413239_1012413248 13 Left 1012413239 6:98984194-98984216 CCTAAGCCCCAGTGTATTTGGAG No data
Right 1012413248 6:98984230-98984252 AAGGTAGTTAATATTAAATGAGG No data
1012413239_1012413245 -10 Left 1012413239 6:98984194-98984216 CCTAAGCCCCAGTGTATTTGGAG No data
Right 1012413245 6:98984207-98984229 GTATTTGGAGATAGGGCCTGTGG No data
1012413239_1012413250 22 Left 1012413239 6:98984194-98984216 CCTAAGCCCCAGTGTATTTGGAG No data
Right 1012413250 6:98984239-98984261 AATATTAAATGAGGTCAAAAGGG No data
1012413239_1012413246 -6 Left 1012413239 6:98984194-98984216 CCTAAGCCCCAGTGTATTTGGAG No data
Right 1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012413239 Original CRISPR CTCCAAATACACTGGGGCTT AGG (reversed) Intergenic
No off target data available for this crispr