ID: 1012413246

View in Genome Browser
Species Human (GRCh38)
Location 6:98984211-98984233
Sequence TTGGAGATAGGGCCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012413238_1012413246 -5 Left 1012413238 6:98984193-98984215 CCCTAAGCCCCAGTGTATTTGGA No data
Right 1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG No data
1012413239_1012413246 -6 Left 1012413239 6:98984194-98984216 CCTAAGCCCCAGTGTATTTGGAG No data
Right 1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG No data
1012413236_1012413246 14 Left 1012413236 6:98984174-98984196 CCAGATTCAAATATTGAAGCCCT No data
Right 1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012413246 Original CRISPR TTGGAGATAGGGCCTGTGGA AGG Intergenic
No off target data available for this crispr