ID: 1012418328

View in Genome Browser
Species Human (GRCh38)
Location 6:99034341-99034363
Sequence CAGTTTGCAAAGATGTGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012418328_1012418330 15 Left 1012418328 6:99034341-99034363 CCGAGCCACATCTTTGCAAACTG No data
Right 1012418330 6:99034379-99034401 TCTGTGCACCCAGCATTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012418328 Original CRISPR CAGTTTGCAAAGATGTGGCT CGG (reversed) Intergenic
No off target data available for this crispr