ID: 1012420822

View in Genome Browser
Species Human (GRCh38)
Location 6:99063454-99063476
Sequence GCGTCTCCACTGCCTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012420818_1012420822 -6 Left 1012420818 6:99063437-99063459 CCTCTGTTTCTCATTATGCGTCT No data
Right 1012420822 6:99063454-99063476 GCGTCTCCACTGCCTGGAAGGGG No data
1012420817_1012420822 8 Left 1012420817 6:99063423-99063445 CCTAGCATGGCTTTCCTCTGTTT No data
Right 1012420822 6:99063454-99063476 GCGTCTCCACTGCCTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012420822 Original CRISPR GCGTCTCCACTGCCTGGAAG GGG Intergenic
No off target data available for this crispr