ID: 1012421788

View in Genome Browser
Species Human (GRCh38)
Location 6:99073547-99073569
Sequence CAAGATCCAAGAGAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012421788_1012421790 -7 Left 1012421788 6:99073547-99073569 CCTTCCTTCTCTCTTGGATCTTG No data
Right 1012421790 6:99073563-99073585 GATCTTGATCCTGCAAATCCTGG No data
1012421788_1012421792 2 Left 1012421788 6:99073547-99073569 CCTTCCTTCTCTCTTGGATCTTG No data
Right 1012421792 6:99073572-99073594 CCTGCAAATCCTGGCTTCCTTGG No data
1012421788_1012421793 5 Left 1012421788 6:99073547-99073569 CCTTCCTTCTCTCTTGGATCTTG No data
Right 1012421793 6:99073575-99073597 GCAAATCCTGGCTTCCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012421788 Original CRISPR CAAGATCCAAGAGAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr