ID: 1012421789

View in Genome Browser
Species Human (GRCh38)
Location 6:99073551-99073573
Sequence GGATCAAGATCCAAGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012421789_1012421792 -2 Left 1012421789 6:99073551-99073573 CCTTCTCTCTTGGATCTTGATCC No data
Right 1012421792 6:99073572-99073594 CCTGCAAATCCTGGCTTCCTTGG No data
1012421789_1012421793 1 Left 1012421789 6:99073551-99073573 CCTTCTCTCTTGGATCTTGATCC No data
Right 1012421793 6:99073575-99073597 GCAAATCCTGGCTTCCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012421789 Original CRISPR GGATCAAGATCCAAGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr