ID: 1012421790

View in Genome Browser
Species Human (GRCh38)
Location 6:99073563-99073585
Sequence GATCTTGATCCTGCAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012421788_1012421790 -7 Left 1012421788 6:99073547-99073569 CCTTCCTTCTCTCTTGGATCTTG No data
Right 1012421790 6:99073563-99073585 GATCTTGATCCTGCAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012421790 Original CRISPR GATCTTGATCCTGCAAATCC TGG Intergenic
No off target data available for this crispr