ID: 1012429860

View in Genome Browser
Species Human (GRCh38)
Location 6:99153055-99153077
Sequence CTGCTGGCCTTGAAGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012429854_1012429860 28 Left 1012429854 6:99153004-99153026 CCATAACAGAGTATCTAGAGGTC No data
Right 1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012429860 Original CRISPR CTGCTGGCCTTGAAGAAACA AGG Intergenic
No off target data available for this crispr