ID: 1012440475

View in Genome Browser
Species Human (GRCh38)
Location 6:99257588-99257610
Sequence GTGTCTACAAAAATTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012440475_1012440478 4 Left 1012440475 6:99257588-99257610 CCTGGCTAAATTTTTGTAGACAC No data
Right 1012440478 6:99257615-99257637 TCTGCCTCTGTTGCCCAGGCTGG 0: 28
1: 4103
2: 72602
3: 174273
4: 251501
1012440475_1012440482 18 Left 1012440475 6:99257588-99257610 CCTGGCTAAATTTTTGTAGACAC No data
Right 1012440482 6:99257629-99257651 CCAGGCTGGTATCAAACTCTTGG 0: 16
1: 1753
2: 24180
3: 45205
4: 60678
1012440475_1012440477 0 Left 1012440475 6:99257588-99257610 CCTGGCTAAATTTTTGTAGACAC No data
Right 1012440477 6:99257611-99257633 GAGGTCTGCCTCTGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012440475 Original CRISPR GTGTCTACAAAAATTTAGCC AGG (reversed) Intergenic
No off target data available for this crispr