ID: 1012445468

View in Genome Browser
Species Human (GRCh38)
Location 6:99302809-99302831
Sequence ATCACTTTTGAATGTAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012445468 Original CRISPR ATCACTTTTGAATGTAGCTC TGG (reversed) Intronic
909590867 1:77347540-77347562 TTCACTTTTCAATTTAGTTCTGG - Intronic
913160938 1:116146102-116146124 AGCACCTTTGTATCTAGCTCAGG - Intergenic
913987210 1:143575849-143575871 ATAACTTTTGTGTCTAGCTCAGG + Intergenic
918634026 1:186753528-186753550 AGCACTTTTGAAGCGAGCTCCGG + Intergenic
919167500 1:193914379-193914401 ATCACTCTTGAATGAAGCAGAGG + Intergenic
921967967 1:221112976-221112998 ATCACTTTTAAATGTATCATTGG - Intergenic
1071003885 10:80860142-80860164 AGAACTTTTGTATCTAGCTCAGG + Intergenic
1071217279 10:83422567-83422589 ATCACTTTTTAATTTTGTTCAGG - Intergenic
1071516408 10:86300686-86300708 AACACTTATGAATGAAGCTATGG + Intronic
1071963665 10:90831731-90831753 ATAACTTTTGTGTCTAGCTCAGG - Intronic
1073731082 10:106289065-106289087 ATCAATTTTGTATATAGTTCTGG + Intergenic
1074264637 10:111889328-111889350 GTCACTTTTTAATCTACCTCTGG - Intergenic
1078179091 11:8995487-8995509 ATCACTTTTGATGGGAGGTCAGG - Intronic
1080162936 11:29200893-29200915 ATGACCTTTGAAGGTAGCTCTGG - Intergenic
1085815591 11:79733926-79733948 ATCACTTTTGAATGTTGGTCAGG + Intergenic
1086724734 11:90167789-90167811 AGAACTTTTGTGTGTAGCTCAGG + Intronic
1087118662 11:94549779-94549801 GTCATTTTTGAATGTGTCTCAGG + Exonic
1091928109 12:4371893-4371915 CCCACTTTTGAATCTAGCACAGG - Intronic
1092366652 12:7881919-7881941 ATAACTTTTGTGTCTAGCTCAGG + Intronic
1093583134 12:20806987-20807009 AGTACTTTTGAGTCTAGCTCAGG - Intergenic
1095296904 12:40536956-40536978 ACCAGTTTTGAATATAGTTCTGG - Intronic
1097128816 12:56795387-56795409 AGAACTTTTGTATCTAGCTCAGG - Intergenic
1097353299 12:58572688-58572710 AACACTTCTGAATGTTGCTGTGG + Intronic
1098110128 12:67112922-67112944 ATGAATTTTGAATGTATCTTGGG - Intergenic
1103189331 12:118987434-118987456 TTCACTTTTAAATGTGGCTTTGG + Intronic
1104177372 12:126346038-126346060 CTAACTTTTGAATGCAGGTCTGG - Intergenic
1105496447 13:20934926-20934948 ATAACTTTTGAATCTAGCTGAGG + Intergenic
1106041207 13:26095564-26095586 ATCATTTCTGAAAGTAGTTCAGG + Intergenic
1107259256 13:38471978-38472000 AGAACTTTTGTATCTAGCTCAGG - Intergenic
1112302701 13:98244766-98244788 GTCACCTTTGAATTTAACTCTGG - Intronic
1113045424 13:106149948-106149970 ATCAGTTTTGAAAGTATTTCTGG + Intergenic
1115805331 14:37044541-37044563 ATCAATATTGAATGTACCACAGG + Intronic
1116517810 14:45821026-45821048 ATTACTTTTGAAAGTATCGCAGG + Intergenic
1116657110 14:47666523-47666545 AGAACTTTTGAGTCTAGCTCAGG + Intronic
1117892227 14:60437859-60437881 ATAAGCTTTAAATGTAGCTCTGG + Intronic
1118215750 14:63807020-63807042 TTCTCTTTTTAATGTAACTCTGG + Intergenic
1119693520 14:76695046-76695068 ATCACTTTAGAATGCAGGTTAGG - Intergenic
1120209739 14:81623234-81623256 ATAACTTTTGTGTCTAGCTCAGG - Intergenic
1121923134 14:97902017-97902039 TTTACTTTTGCATGTTGCTCAGG + Intergenic
1122493322 14:102134955-102134977 AGAACCTTTGTATGTAGCTCAGG - Intronic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1124723363 15:32132963-32132985 ATCATTTTTCAATGAACCTCTGG + Intronic
1126196502 15:45937440-45937462 ATCACTTGAGAGTGTAGCTGTGG - Intergenic
1127060174 15:55174376-55174398 ATTACTTTTTAAAGAAGCTCTGG - Intergenic
1127526407 15:59796521-59796543 ATCACTTCTAAATGTAGCTTAGG - Intergenic
1128110988 15:65076038-65076060 AGAACTTTTGTATCTAGCTCAGG + Intronic
1129643122 15:77402950-77402972 ATCACTTTGAAATGCAGTTCTGG + Intronic
1133474768 16:6109958-6109980 ATCACTTTTTTATGTATCTTGGG + Intronic
1137820425 16:51439429-51439451 AGCACCTTTGAAAATAGCTCTGG + Intergenic
1138688892 16:58749499-58749521 AGCACTTTTGTGTCTAGCTCAGG + Intergenic
1146969297 17:37059499-37059521 ATCACTATTGATATTAGCTCTGG + Intergenic
1149296443 17:55265802-55265824 AGCTCTTTTAAATGTAGCTCAGG - Intronic
1149754072 17:59173163-59173185 ATAACTTTTGTGTCTAGCTCAGG + Intronic
1152052230 17:77989298-77989320 ATGACTTCTGAATTTCGCTCTGG + Intergenic
1152598030 17:81247417-81247439 ATTCCTTTTGACTGTTGCTCTGG - Intronic
1155297703 18:24400398-24400420 TTCACTTTTCAATGTGGGTCAGG - Intergenic
1159166640 18:64710666-64710688 AACACATTTGAATGAAGCTCAGG - Intergenic
926097614 2:10092303-10092325 AGAACTTTTGACTCTAGCTCAGG + Intergenic
929303300 2:40330930-40330952 TTCAATTTTGTATGTGGCTCTGG - Intronic
931117814 2:59183521-59183543 GTCATGTTTGAATGTAGCTAAGG + Intergenic
931525501 2:63148018-63148040 ATCACTTTTTATTATAACTCTGG - Intronic
932619661 2:73258206-73258228 TTCAGCTTTGAATTTAGCTCTGG + Exonic
932902173 2:75712426-75712448 AGAACTTTTGTATCTAGCTCAGG + Intergenic
933050034 2:77591236-77591258 AGAACTTTTGTATCTAGCTCAGG + Intronic
933145126 2:78842514-78842536 ATCACATTTCACTGTAGCTTTGG - Intergenic
937751318 2:125478831-125478853 AGAACTTTTGTGTGTAGCTCAGG - Intergenic
939003237 2:136759114-136759136 ATAACTTTTGTCTCTAGCTCAGG + Intergenic
941484555 2:166063506-166063528 TTCTCTTTAGAATGTAGCACAGG - Intronic
944927890 2:204483945-204483967 ATCACTTTTGACTGCAAGTCAGG + Intergenic
1169328342 20:4695836-4695858 TTCACTTTTGTATGTAGTTAGGG + Intronic
1169912676 20:10660117-10660139 ATCACTTTTTAAAGGAGCACTGG - Intronic
1172342675 20:34170830-34170852 ATAACTGTGGAATGTAGCTTGGG - Intergenic
1173154255 20:40594512-40594534 ATGAGTTGTAAATGTAGCTCTGG + Intergenic
1173719218 20:45238680-45238702 AACACTGTTGAATGTATCTCTGG - Intergenic
1176984327 21:15419073-15419095 ATAACATGTGAATGTAGCTGTGG + Intergenic
1180019425 21:45112277-45112299 ATCATTTTTGAGTCTAGCTCAGG + Intronic
1184516185 22:44964284-44964306 CTCACTGTTGAATGTGTCTCTGG - Intronic
949691932 3:6650589-6650611 ATCAATTTTAAAAATAGCTCCGG - Intergenic
950797675 3:15523469-15523491 ATAAATTTTGAATGTAGTTCAGG - Intergenic
951415564 3:22417831-22417853 AGAACTTTTGTATCTAGCTCAGG + Intergenic
951734889 3:25852403-25852425 AGAACTTTTGTATCTAGCTCAGG + Intergenic
952355487 3:32579359-32579381 AGAACTTTTGTATCTAGCTCGGG + Intergenic
956908666 3:73794145-73794167 ACCACTTTTGCTTGTAGCTATGG + Intergenic
957056068 3:75444151-75444173 AGAACTTTTGTATCTAGCTCAGG - Intergenic
960868458 3:122226612-122226634 AGAACTTTTGCATCTAGCTCAGG - Intronic
962493158 3:135913711-135913733 AACATCTTTAAATGTAGCTCTGG + Intergenic
963621697 3:147615633-147615655 AAAAGTTTTGAATGTAGCTCAGG - Intergenic
963971583 3:151435955-151435977 ATAACTTTAAAATCTAGCTCAGG - Exonic
963993404 3:151679455-151679477 GTCACATTTCAATGTATCTCTGG - Intergenic
964393663 3:156223468-156223490 AGCACTTTTGTGTCTAGCTCAGG - Intronic
965753110 3:171998459-171998481 AGAACTTTTGTATCTAGCTCAGG - Intergenic
966076191 3:175938226-175938248 AGAACTTTTGTATCTAGCTCAGG + Intergenic
968389238 4:175357-175379 ATCACTTTTGAATAAAACCCTGG + Intergenic
969435569 4:7187319-7187341 AAAACTTCTGAATGTTGCTCAGG + Intergenic
969755121 4:9144201-9144223 AGAACTTTTGTATCTAGCTCAGG + Intergenic
970701818 4:18750325-18750347 ATCACATTTGAATGTTGATATGG - Intergenic
971617894 4:28816682-28816704 TTCACTATTCAATGTAGCACAGG + Intergenic
973041700 4:45477063-45477085 AGAACTTTTGTATCTAGCTCAGG - Intergenic
976102597 4:81581136-81581158 AGAACTTTTGTGTGTAGCTCAGG + Intronic
979286681 4:118933577-118933599 ATAACTTTTGAATCCAGCTAAGG + Intronic
979678488 4:123434961-123434983 ATAACTTTTGTGTCTAGCTCAGG - Intergenic
980343907 4:131586769-131586791 TTCACTTTTAAAAGTATCTCTGG - Intergenic
982647783 4:158044890-158044912 AAAACTTTTGTATTTAGCTCAGG + Intergenic
983656858 4:170091994-170092016 AGAACTTTTGTGTGTAGCTCAGG + Intergenic
984662381 4:182387382-182387404 AGAACTTTTGTATCTAGCTCAGG + Intronic
985422127 4:189794918-189794940 ATCACATTTGAAGGTAACTGGGG - Intergenic
988086856 5:26484827-26484849 ATAACCTTTGTATCTAGCTCAGG - Intergenic
990757557 5:59091471-59091493 ATCAATGTTGTATGTAGCTGAGG - Intronic
993865250 5:93186878-93186900 ACCTCTTTTGAAACTAGCTCAGG - Intergenic
994699418 5:103114435-103114457 ATCACTTCTGTCTGAAGCTCTGG + Intronic
994828449 5:104746426-104746448 ATCACTTCCGAATTTAGCTTTGG - Intergenic
995582024 5:113612454-113612476 ATCACTTTAGGATGCACCTCTGG + Intergenic
995617417 5:113981117-113981139 TTCATTTTTGAATGTCGCTGTGG + Intergenic
1000045751 5:157520698-157520720 ATCACTGATGCATCTAGCTCTGG - Intronic
1000212473 5:159119941-159119963 AGAACTTTTGTATCTAGCTCAGG + Intergenic
1001857678 5:175026894-175026916 ATGACTTTTGAATGCAGCTAGGG + Intergenic
1002385701 5:178865187-178865209 AGTACTTTTGAATGGAGCCCAGG + Intronic
1002591411 5:180293302-180293324 TTCACTTTTCAACGTAGATCTGG - Intergenic
1003420236 6:5951076-5951098 ATCACTAGTTAATGTAACTCTGG - Intergenic
1003489913 6:6612714-6612736 AGAACTTTTGCATCTAGCTCAGG - Intronic
1003755818 6:9118721-9118743 ATTATTCATGAATGTAGCTCGGG - Intergenic
1003908265 6:10721436-10721458 AGAACTTTTGTATCTAGCTCAGG + Intergenic
1004234385 6:13860924-13860946 CTAACTTTTGTGTGTAGCTCAGG + Intergenic
1005712120 6:28512481-28512503 AGCACTTTTGTGTCTAGCTCAGG + Intronic
1005978079 6:30815645-30815667 AGAACCTTTGTATGTAGCTCAGG - Intergenic
1006008453 6:31021694-31021716 AGAACCTTTGTATGTAGCTCAGG + Intronic
1008254168 6:49276047-49276069 AACACTTTTGTGTCTAGCTCGGG + Intergenic
1009510701 6:64547391-64547413 ATAACTTTTGTGTCTAGCTCAGG - Intronic
1012445468 6:99302809-99302831 ATCACTTTTGAATGTAGCTCTGG - Intronic
1013858183 6:114601136-114601158 ATCACTTTTATATGTAACTTTGG + Intergenic
1018307977 6:162478277-162478299 ATCACTGTTGAAAGTGACTCTGG + Intronic
1021469994 7:20991105-20991127 ATCACTTTTAAAGTTAGCTAGGG + Intergenic
1023730550 7:43187846-43187868 ATCACTTTTTAGTGTAGTTTTGG - Intronic
1023975229 7:45024116-45024138 ATCAGTTTTGAATTTAGTTCTGG + Intronic
1024442310 7:49434827-49434849 TTCACTGTAGAATGCAGCTCAGG + Intergenic
1024724970 7:52183588-52183610 ATCACTAATGAATGAAGCTACGG - Intergenic
1025752906 7:64308372-64308394 ATCATTTTTAAATATATCTCTGG + Intronic
1030102029 7:105955519-105955541 AGAACTTTTGTGTGTAGCTCAGG - Intronic
1030932006 7:115536286-115536308 ATCTCTTTTGTATGTACCACTGG - Intergenic
1032912944 7:136454921-136454943 ATCACTTTTGAAAGTGGTTATGG - Intergenic
1037156517 8:15706921-15706943 ATCAGTTTTTTATGTTGCTCTGG - Intronic
1039061401 8:33574553-33574575 AGAACTTTTGTATCTAGCTCAGG + Intergenic
1040000985 8:42576010-42576032 ATAACTTTTGTGTCTAGCTCAGG + Intergenic
1041034541 8:53775488-53775510 AGAACCTTTGTATGTAGCTCAGG - Intronic
1041963007 8:63641314-63641336 ATCACTTTTTAATGCAGCGAGGG - Intergenic
1042124078 8:65519683-65519705 ATCACCTTAGAAAGTTGCTCAGG + Intergenic
1042467875 8:69149054-69149076 ATTGCTTTTAAATTTAGCTCTGG - Intergenic
1043709990 8:83403600-83403622 AGAACCTTTGTATGTAGCTCAGG + Intergenic
1044421602 8:92002282-92002304 CTTTCTTTTAAATGTAGCTCTGG - Intronic
1044562707 8:93628536-93628558 ATCACTTTTTCATTTATCTCAGG + Intergenic
1048079210 8:131106756-131106778 ATCACTTTTGAATAAACCACAGG + Intergenic
1048777958 8:137968265-137968287 CTCACTTTGCAATGTAACTCTGG + Intergenic
1050084104 9:1946431-1946453 ATTACTTTCAAATGTAGCTCAGG - Intergenic
1052542310 9:29826973-29826995 ATCTTTTTTGAATGTATCTGTGG + Intergenic
1053436229 9:38076328-38076350 ATAACTTTTGTGTCTAGCTCAGG + Intergenic
1055355370 9:75431975-75431997 ATCACTTTTCCATGGAGATCTGG + Intergenic
1056181131 9:84083435-84083457 ATCAATTTTGAATAAAACTCAGG - Intergenic
1057383818 9:94590851-94590873 AGAACCTTTGTATGTAGCTCAGG - Intronic
1060390940 9:123276220-123276242 ATGACTTTTGAATGTCCCACTGG - Intergenic
1060451100 9:123741184-123741206 ATCACTTTTAAAAGTTGCTGAGG - Intronic
1186059515 X:5689118-5689140 GTCACTTTTGAATCTAGTTTTGG + Intergenic
1186212935 X:7269176-7269198 TTCTCTTTTGAATGAACCTCTGG + Intronic
1186436128 X:9544422-9544444 AGCACTTTTGCATGTCTCTCTGG - Intronic
1187978627 X:24730819-24730841 ATCACTTCTGAAGGAAGCTGGGG + Intronic
1188141268 X:26554908-26554930 CTCAATATTCAATGTAGCTCTGG - Intergenic
1188812934 X:34674449-34674471 ATCACTTATTTATGTAGCTATGG + Intergenic
1189014620 X:37084261-37084283 ATCACTTTCCATTGTAGCTATGG - Intergenic
1191135443 X:57059003-57059025 AACACTTCTGAAGGTAGCTCAGG + Intergenic
1191900582 X:66036028-66036050 ATCACTTCTGGAAGTAGGTCAGG + Intronic
1192867895 X:75155453-75155475 TTAACTTATGAATGTAGCTATGG - Intronic
1197415891 X:126172353-126172375 ATCACTTATGAAGGTGGCTTGGG - Intergenic
1202109960 Y:21408055-21408077 AGAACTTTTGTATCTAGCTCAGG + Intergenic