ID: 1012447595

View in Genome Browser
Species Human (GRCh38)
Location 6:99322539-99322561
Sequence TGCAGAAGGTGGGTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012447595_1012447604 29 Left 1012447595 6:99322539-99322561 CCAGTGAAAACCCACCTTCTGCA 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1012447604 6:99322591-99322613 GGTCAGATGACCTAGTCACATGG 0: 1
1: 0
2: 1
3: 3
4: 96
1012447595_1012447599 2 Left 1012447595 6:99322539-99322561 CCAGTGAAAACCCACCTTCTGCA 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1012447599 6:99322564-99322586 AAAAACTAGTAGCCCTCAAAAGG No data
1012447595_1012447600 8 Left 1012447595 6:99322539-99322561 CCAGTGAAAACCCACCTTCTGCA 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1012447600 6:99322570-99322592 TAGTAGCCCTCAAAAGGACCTGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012447595 Original CRISPR TGCAGAAGGTGGGTTTTCAC TGG (reversed) Intronic
900742407 1:4338765-4338787 TGCAGAAGGTACCTCTTCACAGG - Intergenic
903494228 1:23754040-23754062 GGTAGAAGGAGAGTTTTCACTGG + Intronic
906478349 1:46184730-46184752 TACAGAAGGTGGCCATTCACAGG - Intronic
913321819 1:117594040-117594062 TGCAGAACGTGGGCTATCAGGGG + Intergenic
916599277 1:166276329-166276351 GGCAGTAGGTGAGTCTTCACAGG + Intergenic
916966143 1:169944965-169944987 GTTAGAAGGTGGGGTTTCACTGG + Intronic
922866163 1:228863153-228863175 TGCAGAAGCTGGCCCTTCACAGG - Intergenic
923060685 1:230470563-230470585 AGGAGAAGGTGAATTTTCACAGG + Intergenic
924566991 1:245207248-245207270 TGCAGAAGGGTGCTTCTCACAGG + Intronic
1063714506 10:8513895-8513917 TGCAGAAGGTGAGTATCCATAGG - Intergenic
1064009996 10:11727970-11727992 GGCAGAGGGTGGGTTTGCACTGG + Intergenic
1064014771 10:11763379-11763401 TGTAGAAGGTGGCTTTGCCCAGG - Exonic
1064352170 10:14586235-14586257 AAGAGAAGGTGGGTTTTCAGTGG - Intronic
1066479415 10:35781153-35781175 TGCAGAAGGTGGACCTCCACTGG - Intergenic
1070355724 10:75638244-75638266 GGCAGAAGGCAGGTTTTCAGTGG + Intronic
1070445188 10:76492728-76492750 GGCAGAAGGTGCCTCTTCACAGG + Intronic
1071290971 10:84188887-84188909 TCCAGAAGGTGGTTTACCACGGG - Intergenic
1071891142 10:90008716-90008738 TCCAGAAGGTGGAATTTAACAGG + Intergenic
1075631721 10:124004499-124004521 GGCAGAAGGTGGGGATTCTCAGG - Intergenic
1075827912 10:125375897-125375919 AGTTGAAGGTGGATTTTCACAGG - Intergenic
1080819574 11:35792586-35792608 CCCAGAAGGAGGGATTTCACTGG - Intronic
1080984929 11:37451233-37451255 TGCAGAAGGTGTGTTTGAAATGG + Intergenic
1081041604 11:38221271-38221293 TGCAGAAGGGTGCTTCTCACAGG + Intergenic
1081042342 11:38226886-38226908 TGCAGAAGGGTGCTTCTCACAGG + Intergenic
1081333008 11:41826971-41826993 TGCAGAAGGTGAGATTACATAGG + Intergenic
1081994978 11:47358543-47358565 TGCAGAGGGTGCGTGTGCACAGG - Intronic
1083099399 11:60287391-60287413 TGGAGAAGGTTAGTTATCACAGG - Intronic
1083233817 11:61339428-61339450 TACACAAGGTGGGCTTCCACCGG + Exonic
1084879555 11:72160548-72160570 TGCTGAATGTGGGTTATCAGGGG + Intergenic
1085491509 11:76923311-76923333 TGCAGAAGGAGGGCTTACAAAGG - Intronic
1086558242 11:88137140-88137162 TGCTTTAGGTTGGTTTTCACTGG - Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1092128991 12:6095445-6095467 TGCAGAAGGTGGGTGTGGACTGG - Exonic
1093121265 12:15274288-15274310 TGGGGAAGGTGTGTATTCACTGG + Intronic
1093502443 12:19828056-19828078 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1096919938 12:55072770-55072792 GCATGAAGGTGGGTTTTCACCGG + Intergenic
1098884272 12:75944532-75944554 TGCTGAAGGAGGGTATTAACTGG - Intergenic
1100305250 12:93344401-93344423 TGGAGAAGGAGGGTTATCCCTGG - Intergenic
1100859434 12:98788577-98788599 TGCAGGAGGTGTGGTTTCAATGG - Intronic
1101843690 12:108345244-108345266 TGCAGGAGGTGGGTTTTATGAGG + Intergenic
1104040189 12:125124898-125124920 TGGAGACTGTGGGTTTCCACTGG - Exonic
1104043941 12:125148308-125148330 GGCAGCAGGTGGGTCTGCACTGG + Intergenic
1104612470 12:130241002-130241024 TGCAGAGGGAGGGCTTTGACTGG - Intergenic
1107170962 13:37341610-37341632 GCCTGAAGGTGGGGTTTCACTGG - Intergenic
1108559432 13:51628070-51628092 TCTTGAAGGTGGGGTTTCACTGG + Intronic
1108847113 13:54691990-54692012 TCCTGAAGGTTGGGTTTCACTGG + Intergenic
1109720750 13:66273267-66273289 AGCAGAAGGTTAGTTCTCACAGG + Intergenic
1110401212 13:75093918-75093940 TGCAGAAGGTACCTCTTCACAGG - Intergenic
1111202850 13:84962118-84962140 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1111841672 13:93457057-93457079 GGCAGAAGGTGCCTCTTCACAGG - Intronic
1111957840 13:94777450-94777472 TGCTGAAGGTGAATTTTCTCAGG - Intergenic
1113020324 13:105877793-105877815 TGCAGAGGGAGGGATTTCATGGG - Intergenic
1114632069 14:24165473-24165495 TGCAGAGTGTGGGTGTTCCCAGG + Intronic
1115345575 14:32339485-32339507 TGAGGAAGCTGGGGTTTCACAGG + Intronic
1116740649 14:48749959-48749981 TGCAGTAGGTTTGTTTACACCGG - Intergenic
1117715040 14:58571854-58571876 GGCAGAAGTTGTGTTTTCTCCGG + Intergenic
1118732376 14:68677461-68677483 TACAGGAGATGGGTTTTCAGTGG - Intronic
1120348202 14:83317625-83317647 TGGAGAAGTTGGGTGTTCAAAGG + Intergenic
1120877256 14:89386418-89386440 TGCAGGAGGTGCCATTTCACAGG + Intronic
1120885443 14:89448368-89448390 TGCATAAGGTGGGTGCTCACTGG + Intronic
1122311908 14:100802818-100802840 TCCAGAAGGTGCTTTCTCACTGG - Intergenic
1202895198 14_GL000194v1_random:2664-2686 TGCAGGAGGTGGGCTACCACAGG - Intergenic
1124429327 15:29592690-29592712 TGTTGAAGCTGGGTTCTCACGGG + Intergenic
1124436263 15:29651920-29651942 GCCAGAAGGTGGGGCTTCACTGG - Intergenic
1125191889 15:37003102-37003124 TGCAGCAGGTTGGTTTGCTCTGG - Intronic
1127211260 15:56777139-56777161 TCCAGAATGAGGGTTTTCAAGGG - Intronic
1128637500 15:69312605-69312627 AGGAGAAGGGGGGTTTTCATGGG - Intronic
1132574019 16:656530-656552 TGCAGCAGGTGGGGTTTGGCAGG + Exonic
1132757944 16:1495033-1495055 TTGAGAAGCTGGGTTTTCAGAGG + Intronic
1133312841 16:4861641-4861663 TGCCGATGGTGGGTTTTAATGGG - Intronic
1138205405 16:55120699-55120721 GGCAGAAGCTGGGTCTTCCCAGG + Intergenic
1139014992 16:62678996-62679018 TGCAGAAGGGTGCTTCTCACAGG + Intergenic
1140183251 16:72741915-72741937 AGAACAAAGTGGGTTTTCACAGG - Intergenic
1142132286 16:88436567-88436589 GGCAGCAGGTGGGTGTTCCCGGG - Exonic
1144495129 17:15741117-15741139 TGCAGGAGGTGGGCTACCACAGG + Exonic
1144639093 17:16927779-16927801 TGCAGGAGGTGGGCTACCACAGG - Intergenic
1146549523 17:33768611-33768633 GCCTGAAGGTGGGGTTTCACTGG - Intronic
1147348974 17:39825057-39825079 GGCAGAAGGCAGCTTTTCACAGG - Intronic
1149058802 17:52396257-52396279 TGTAGAAGGTGGGTCTCAACAGG - Intergenic
1150346984 17:64411870-64411892 TGCAGCAAGTGGGTTGTCGCGGG + Intronic
1150868323 17:68877696-68877718 TGCAGAAGGTAGGTTCTGAGAGG - Intronic
1151943865 17:77308809-77308831 TGGAGAGGGTGGCTTTTTACAGG + Intronic
1152755163 17:82084161-82084183 TGCAGCAGGTGGGTCAGCACAGG + Intronic
1154337913 18:13480877-13480899 GCCAGGACGTGGGTTTTCACTGG - Intronic
1156449333 18:37258253-37258275 TGCAGAGGGGGGTGTTTCACGGG - Intronic
1157718613 18:49906475-49906497 TGCAGAAGGTGAAATATCACAGG - Exonic
1159677855 18:71308250-71308272 GGCAGAAGGTGTCTTTTCACAGG - Intergenic
1159766909 18:72502536-72502558 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1160109630 18:76013957-76013979 TGCAGAAAGAGGGTCTTTACAGG - Intergenic
1160353044 18:78201379-78201401 GGCAAAAGCTTGGTTTTCACTGG - Intergenic
1160843534 19:1156898-1156920 TGCAGAGGGTGGGCGTTCTCAGG - Intronic
1160843547 19:1156941-1156963 TGCAGAGGGTGGGCGTTCTCAGG - Intronic
1161118503 19:2512553-2512575 TGCAGATGGTGGGGTTAAACGGG - Exonic
1164139756 19:22448538-22448560 TGAATAAGGTGGGCTGTCACAGG + Intronic
1164213680 19:23123878-23123900 TGAATGAGGTGGGTTGTCACAGG + Intronic
1164494749 19:28749771-28749793 TGCAAAAGGTGGGTTTACATGGG + Intergenic
1165324269 19:35105012-35105034 TGCAGTAAGTGGGTATTCCCAGG + Intergenic
927025567 2:19065336-19065358 GGCAGAAGGTGCCCTTTCACAGG + Intergenic
927791764 2:26015721-26015743 TCCTGAAGGTGGGTTTTCCAGGG - Intergenic
929657959 2:43752971-43752993 GGGAGAAGGTGAGTTTTCTCTGG - Intronic
933098378 2:78217628-78217650 TGCAAAACATGAGTTTTCACAGG - Intergenic
933363558 2:81319560-81319582 TGCATAAAGTGGTTTTACACTGG + Intergenic
933636702 2:84715986-84716008 TGGAGAAGCTGTTTTTTCACAGG - Intronic
936739669 2:115490258-115490280 GGCAGAAGGTACGTCTTCACAGG + Intronic
938143481 2:128814259-128814281 TGCAGCAGGTGGGCATTCACAGG + Intergenic
938493002 2:131775738-131775760 TGCAGGAGGTGGGCTAGCACAGG + Intergenic
945274561 2:207975298-207975320 TTCAAAACGTGGGTTTTCAATGG + Intronic
946817670 2:223595562-223595584 TGCAGAAGGAGCTTTCTCACAGG - Intergenic
947202441 2:227626719-227626741 TGCAGTAGGTTTGTTTACACCGG + Intronic
948292716 2:236838175-236838197 GGCAGAAGGTGCATCTTCACAGG - Intergenic
948900343 2:240953568-240953590 TGCAGCAAGTGAGTTTTCCCAGG + Intronic
1173670714 20:44796777-44796799 TGAAGAAGCTGGGTTTTGCCTGG + Intronic
1175065092 20:56277462-56277484 GCCTGAAGGTGGGTCTTCACTGG - Intergenic
1175261946 20:57680262-57680284 TGCAGAATGCGGGTGTTGACGGG - Intronic
1176614900 21:9018651-9018673 TGCAGGAGGTGGGCTACCACAGG - Intergenic
1179034767 21:37749928-37749950 TGCAGATAGTTGGTTTGCACTGG - Intronic
1179064351 21:38010463-38010485 TGCATCAGGTGGGTTTTGTCTGG - Intronic
1180692885 22:17732114-17732136 TGTAGTAGGAGGCTTTTCACTGG - Intergenic
1181932739 22:26415756-26415778 TGCAGAAGGTGGGTGGTCAGGGG - Intergenic
1182519441 22:30876980-30877002 TGCAGAAGGTGGGTGGCCAGTGG - Intronic
1183569038 22:38638322-38638344 AGCAGAAGGTGACTTGTCACAGG - Intronic
1184915471 22:47565870-47565892 TGCTGAAGGTGAGATGTCACAGG + Intergenic
1185359001 22:50393837-50393859 TGCTGAAGGTGGATTTGCAAGGG + Intronic
1203246988 22_KI270733v1_random:80493-80515 AGCAGAAGGATGGTTTTCAGAGG + Intergenic
951867320 3:27322793-27322815 TTCAGAAGCTGAGTTTTCAGTGG - Intronic
955054009 3:55440165-55440187 AGCAGGAGGTAGGTTTTTACAGG - Intergenic
957142786 3:76382767-76382789 TGGAGAAAATGGGTTTTCAAGGG + Intronic
958887749 3:99746565-99746587 TGCAGAAGGTGGTTATTAAAGGG + Intronic
959525707 3:107373914-107373936 TCCAGGAGGTTGGCTTTCACAGG - Intergenic
959897073 3:111617259-111617281 GCCTGAAGGTGGGGTTTCACTGG - Intronic
960038572 3:113126546-113126568 TGCAGAAGCTATGTTTTCACTGG - Intergenic
960672366 3:120165876-120165898 TCAAGTAGGTGGGTTTTCCCAGG - Exonic
961715237 3:128853351-128853373 TGGAGAAGGTGCCTTCTCACAGG + Intergenic
962284747 3:134076362-134076384 TGCAGATGGTGGGGATTCTCTGG + Intronic
962936955 3:140090140-140090162 GGCAGGAGGTGGGTTGTCTCGGG + Intronic
965367760 3:167820777-167820799 GCCTGAAGGTGGGGTTTCACTGG - Intronic
965754821 3:172015033-172015055 TGCAGAAGGGGGCTGATCACTGG + Intergenic
968748963 4:2376540-2376562 TGCAGAAGGTACCTCTTCACAGG + Intronic
969085419 4:4652724-4652746 TGAAGAAGTTGGGTTTGCCCTGG + Intergenic
969452589 4:7283363-7283385 AGCAGAAGGTGGGTGTTGGCTGG + Intronic
970359900 4:15298510-15298532 TGCAGAAGGTGAGGTTGGACAGG - Intergenic
971253880 4:24996228-24996250 TGCATAGGGTGGGAATTCACAGG - Intergenic
972290770 4:37687671-37687693 TGGAGGCTGTGGGTTTTCACAGG + Intergenic
972730100 4:41786097-41786119 TGCAGAAGGTGGCCTGTCAAGGG - Intergenic
974124390 4:57677623-57677645 AGCAGAATGTGGGTTGTCAGGGG - Intergenic
974615191 4:64271465-64271487 GCCAGAAGGTGGGGTTTCACGGG - Intergenic
975299691 4:72775172-72775194 ACTTGAAGGTGGGTTTTCACCGG - Intergenic
978061445 4:104344914-104344936 GCCTGAAGGTGGGGTTTCACTGG - Intergenic
979296361 4:119036655-119036677 TCCAGAAGATGGGGTTTCATTGG - Intronic
981415933 4:144493560-144493582 GGCAGATGTTGGGTTTTCAATGG + Intergenic
982343574 4:154331548-154331570 AGCAGATGGAGGGTTTTCACAGG - Intronic
983125885 4:163950107-163950129 GCCTGAAGGTGGGGTTTCACTGG + Intronic
984179235 4:176461784-176461806 TACTGAAGGTGGTTTTTGACTGG - Intergenic
984608876 4:181815860-181815882 TGAAAAGGCTGGGTTTTCACAGG - Intergenic
985105592 4:186496802-186496824 TGAAAAAGGTAGGTGTTCACTGG + Intronic
985699262 5:1360849-1360871 AGCAGGAGCTGGGTGTTCACTGG - Intergenic
986430123 5:7673496-7673518 TGCAGAAGCTGGCTTAACACAGG - Intronic
986568197 5:9136484-9136506 TGGAGAAGGTGGGCACTCACCGG + Exonic
986748990 5:10768702-10768724 TTCAGAAGGGCTGTTTTCACAGG + Intergenic
986851762 5:11820790-11820812 TGCAGGATGTGGGTTTTAAAAGG + Intronic
987984480 5:25128405-25128427 TGAAGAAGGTGAATTTTCTCTGG + Intergenic
988044575 5:25933553-25933575 AGCAGAAGGTGGAGTTTCAAGGG - Intergenic
990087312 5:51994663-51994685 TGCAGATGCTGGAATTTCACTGG - Intergenic
992292525 5:75293630-75293652 TGCAGAAGGTGGGTGATTTCTGG - Intergenic
992385664 5:76282061-76282083 TTCAGAAGGTAAGTTTTCAAAGG - Intronic
992710952 5:79455482-79455504 GGCAGAAGGTACGTCTTCACAGG - Intronic
994884092 5:105536545-105536567 TGAAGCAGGTGGGCATTCACAGG - Intergenic
996321479 5:122222213-122222235 TGCAGTAGCTTGGTCTTCACAGG - Intergenic
997068295 5:130589635-130589657 TGCAGTAGCTTGGGTTTCACAGG - Intergenic
998480556 5:142459329-142459351 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
998773383 5:145571571-145571593 TACAGAAGGTAGATTTTCCCAGG - Intronic
998796936 5:145830468-145830490 TGTAGAAAGTGGGTCTTCTCTGG - Intronic
999527128 5:152419191-152419213 TGCAGAAGGAGTCTTTTCAGTGG + Intronic
999911842 5:156209951-156209973 TGCAGAAGTTGGGCTGGCACTGG - Intronic
1001735855 5:174000021-174000043 TGTAGAAGGTGTGTGTTGACTGG + Intronic
1002082514 5:176745924-176745946 TGGAGGAGCTGGGTTTTCTCTGG - Intergenic
1002375611 5:178786917-178786939 TGGAGACTGTGGGTTTCCACTGG + Intergenic
1004900302 6:20187425-20187447 TGCATACGGTGGGTGTTCATGGG + Intronic
1007288130 6:40762782-40762804 TGCAGAAGGTACTTCTTCACAGG - Intergenic
1007520672 6:42450231-42450253 TGCAGAAGGTGGGTGCTAACTGG + Intronic
1007985210 6:46200666-46200688 TGCAGAAGGTAAGTTTTCACTGG + Intergenic
1008330665 6:50240775-50240797 GCCTGAAGGTGGGATTTCACTGG + Intergenic
1008535541 6:52504054-52504076 TGCTGAAGGTGGGTGATGACTGG + Intronic
1010080235 6:71853116-71853138 TCCAGAAGCTGGGTTTGCTCAGG - Intergenic
1012447595 6:99322539-99322561 TGCAGAAGGTGGGTTTTCACTGG - Intronic
1013151294 6:107448825-107448847 GGCAGAAGGTGCCTCTTCACAGG + Intronic
1013211825 6:107993888-107993910 TGCAGAAAAAGTGTTTTCACTGG + Intergenic
1017201749 6:151762045-151762067 TGCAGAGGTTGTGATTTCACTGG - Intronic
1018575211 6:165252616-165252638 GGCAGAAGGTGCCTCTTCACAGG + Intergenic
1019018145 6:168895363-168895385 TGCACAAAGGGGGTTTTCACAGG - Intergenic
1020740814 7:12014904-12014926 TGCAGTAGGTTTGTTTACACCGG + Intergenic
1021645990 7:22789896-22789918 GGGTGAAGGTGGGGTTTCACCGG + Intergenic
1023561558 7:41479003-41479025 TTCAGAATCTGGATTTTCACAGG + Intergenic
1023607749 7:41945468-41945490 TGCAGAAGGAGAGTGTTCTCTGG - Intergenic
1024188642 7:46982095-46982117 TGCTGAAGGTGGTATTTCAGTGG + Intergenic
1025757205 7:64355991-64356013 GGCAGAAGGTGGGTTTTCTTAGG - Intergenic
1030386947 7:108876748-108876770 TGCATAAGGAGGGCTTACACAGG + Intergenic
1030553001 7:110988262-110988284 TGCAGGAGCTGGGTTGTCAATGG + Intronic
1033440407 7:141373396-141373418 TGCAGAAGGTTGGGTTTCCCTGG + Intronic
1036076579 8:5508785-5508807 TACAGGAGGTGAGTTTCCACTGG - Intergenic
1037186386 8:16068385-16068407 AACAAAAGGTGTGTTTTCACAGG + Intergenic
1037867184 8:22454564-22454586 TGCAGTAGGTTTGTTTACACCGG + Intronic
1038964650 8:32558324-32558346 TGCAGAAGTGGGGTTTTCACTGG - Intronic
1041274373 8:56142326-56142348 TGCTGACGGTGGGTGTGCACAGG + Intergenic
1041965479 8:63670194-63670216 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1043601714 8:81947576-81947598 TACAGTAGGTGGGTTTGCAGGGG - Intergenic
1044833974 8:96277997-96278019 TAAAGAAGCTGGGTCTTCACAGG - Intronic
1045093517 8:98772368-98772390 TTGAGATGGTGAGTTTTCACAGG + Intronic
1045622838 8:104002741-104002763 AGAAGAAGCTGGGCTTTCACTGG + Intronic
1046898603 8:119499702-119499724 TACAGAAGGTACGTCTTCACAGG - Intergenic
1048691052 8:136963776-136963798 TGGAGAAGTTGGGTGTTCAAAGG + Intergenic
1048833957 8:138500588-138500610 TGCAGAAGGCAGGTTTTCAATGG + Intergenic
1049850778 8:144829126-144829148 AGCAGGAGGTGGGCCTTCACAGG - Intronic
1050018411 9:1259888-1259910 TGCAGCAGGTGGGTTTCCTGTGG + Intergenic
1050604243 9:7284042-7284064 TGTAGATGGTGGGTTTTTAAGGG + Intergenic
1050983697 9:12054529-12054551 TGCAGAAGGGTGCTTCTCACAGG - Intergenic
1052552562 9:29969872-29969894 GCCTGAAGGTGGGGTTTCACCGG + Intergenic
1053530798 9:38879102-38879124 TGCAGATGGTGTGTATTCACAGG - Intergenic
1054203021 9:62103535-62103557 TGCAGATGGTGTGTATTCACAGG - Intergenic
1054635342 9:67484830-67484852 TGCAGATGGTGTGTATTCACAGG + Intergenic
1054714083 9:68540277-68540299 TGGCTTAGGTGGGTTTTCACTGG + Intronic
1054747428 9:68868923-68868945 TCCAAAAGGTGGGTATTCCCTGG - Intronic
1054859191 9:69931984-69932006 TGCAGTAGGAAGGTTTTTACCGG + Intergenic
1060888958 9:127176173-127176195 GGCAGAAGCTTGATTTTCACAGG + Intronic
1061941699 9:133887369-133887391 AGCAGAAGCTGGATTTTCAGAGG + Intronic
1203463321 Un_GL000220v1:63554-63576 AGCAGAAGGATGGTTTTCAGAGG + Intergenic
1186076250 X:5882557-5882579 TGCAGAAAGAGGGTTCTCTCTGG - Intronic
1186183996 X:7002337-7002359 TGCATATGGTGGGTTTTCAATGG + Intergenic
1188128538 X:26400657-26400679 GGCAGAAGGTGCCTATTCACAGG + Intergenic
1188896544 X:35675789-35675811 TGCAGAAGGTGCATTTCCTCGGG + Intergenic
1188903765 X:35766487-35766509 TGCAGAAGGTGTGATTACCCAGG - Intergenic
1191601867 X:63017269-63017291 TGCAGAAGGTGGGTGATTTCTGG - Intergenic
1192784502 X:74323325-74323347 CACAGAAGGTGGGCTTGCACTGG + Intergenic
1192804131 X:74494994-74495016 CACAGAAGGTGGGCTTGCACTGG - Intronic
1193647531 X:84088124-84088146 TTCAGAAGGTGGGTAATAACAGG - Intronic
1200039503 X:153355385-153355407 TCCAGCAGGTGGGTGTTCAAAGG - Intronic