ID: 1012448941

View in Genome Browser
Species Human (GRCh38)
Location 6:99334702-99334724
Sequence TCCCTCTGGTGGCAGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012448941 Original CRISPR TCCCTCTGGTGGCAGTGTGG AGG (reversed) Intronic
900531002 1:3153161-3153183 TCCCTCAGGTGGCAGGGGAGGGG - Intronic
901038038 1:6348099-6348121 ACCCTCTGGTGGCTGTGGGGAGG - Intronic
901090290 1:6636301-6636323 CCCCTCCGGTGGTAGTGAGGAGG - Intronic
901421480 1:9154199-9154221 TCCCTCTGGTGGCAGTGCTGGGG - Intergenic
901937431 1:12636469-12636491 TCCCTTGGGAGGCAGGGTGGGGG - Intergenic
902388750 1:16090766-16090788 TCCCTTGGCTGGCAATGTGGAGG + Intergenic
902908486 1:19577287-19577309 TCCCTTTGGGAGCAATGTGGGGG - Intergenic
903210556 1:21815853-21815875 CCCCCATGGTGACAGTGTGGGGG - Intronic
903732080 1:25503973-25503995 GCCCTCTGGTGGCAGCTGGGGGG - Intergenic
904026103 1:27504699-27504721 TCCCTCTGGTGAGAATGGGGAGG + Intergenic
904880798 1:33695384-33695406 TCACTGTGGTGGCAGTATGATGG + Intronic
904920799 1:34006455-34006477 TTCCTCTGGAAACAGTGTGGAGG - Intronic
905031074 1:34885059-34885081 TCCACCTGGTGGCAGGGTGGAGG + Exonic
905871970 1:41409644-41409666 GGCCTCTGGTGGGAGTGTGTGGG + Intergenic
905988396 1:42309808-42309830 TCCCTCAGGGGCCAGTGTGAAGG + Intronic
906071933 1:43023172-43023194 TCCCTCTGGCTGCAGCTTGGAGG + Intergenic
906103391 1:43277282-43277304 TCCCATCGGTGGCAGTGAGGTGG + Intergenic
906104531 1:43284022-43284044 TCCCTGTGGGGGCAGAGTGTGGG - Intronic
906218937 1:44062021-44062043 TTACTGAGGTGGCAGTGTGGTGG - Intergenic
906246670 1:44280698-44280720 TCTCTCTGGCTGCAGTGTAGAGG - Intronic
906400669 1:45502003-45502025 TCACACTGGCTGCAGTGTGGAGG - Intronic
906798223 1:48714300-48714322 TCCCTGGGGTGGCACTGTGGAGG - Intronic
907520460 1:55020266-55020288 TCCCTCTGGTGGGTGTGGTGGGG - Intergenic
908312325 1:62897104-62897126 TCCCTCTGTTAGCAGTGGGAAGG - Intergenic
908326444 1:63028381-63028403 ACACTCTGGTGGCATTATGGAGG - Intergenic
908794641 1:67819042-67819064 TCATGCTGGTGGCAGTGTGCAGG + Intronic
909878258 1:80839031-80839053 TCTGTGTGGTGGCAGTGTGCTGG - Intergenic
911037462 1:93566003-93566025 TTACTCTGGTGTCTGTGTGGAGG - Intronic
911802433 1:102158892-102158914 TCCCTCAGGTTGGAGTGTAGTGG - Intergenic
912924903 1:113905256-113905278 TCCCTCTGGTGGAGCTGCGGCGG + Exonic
913179490 1:116307710-116307732 TCACTCAGGTAGCAGTGTGAAGG - Intergenic
913318336 1:117571758-117571780 TACCTCTCGTGGGAGTGTCGGGG - Intergenic
914207086 1:145541564-145541586 TCACTCTGGCGGCTGTATGGTGG + Intergenic
916795630 1:168164776-168164798 TCACTCTGGTTGCAGGGTGGAGG + Intergenic
916997153 1:170313268-170313290 TCACTCTGGTAGCAGTGCGGAGG - Intergenic
918164989 1:181936497-181936519 TCAGCCTGATGGCAGTGTGGGGG - Intergenic
919898970 1:202029754-202029776 TCTCACTGATGGCAATGTGGAGG + Intergenic
920304998 1:205013000-205013022 CCTCTCTGGTGGCGCTGTGGTGG + Intronic
920461706 1:206145665-206145687 TCCATCTGGGGGCAGGGTGCAGG + Intergenic
920671706 1:208008660-208008682 TCCCTCTGGCAGGAGTGTAGAGG - Intergenic
921137433 1:212274094-212274116 TTACACTGTTGGCAGTGTGGAGG - Intergenic
922882014 1:228988218-228988240 TGCCTGTGCTGGCATTGTGGAGG + Intergenic
923031815 1:230255226-230255248 TTCCGCGTGTGGCAGTGTGGTGG + Exonic
924062811 1:240193804-240193826 TAACTCTGGAGGCATTGTGGAGG - Intronic
924628044 1:245711816-245711838 TTCCTCAGGTGGCAGCGGGGTGG - Intergenic
924815440 1:247437623-247437645 GCCCTCTGGGGGCTCTGTGGTGG + Intronic
1063787494 10:9402242-9402264 TCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1065532985 10:26691198-26691220 TCACCCTGGCTGCAGTGTGGTGG + Intergenic
1066304885 10:34130684-34130706 TCACTCTGGTGGCTATGAGGGGG + Intronic
1067024008 10:42827646-42827668 TCCCTCTGGGGGATGGGTGGTGG + Intronic
1067238343 10:44470092-44470114 TCACTCTGGCTGCTGTGTGGAGG + Intergenic
1070218952 10:74420026-74420048 TCCCCCTGGTGGCAGTGTCTGGG - Intronic
1072186747 10:93047105-93047127 TCTCTCTGGCAGCAGTGTGGAGG + Intronic
1072236182 10:93455623-93455645 TCCCTCAGGTTGGAGTGCGGTGG - Intronic
1072794058 10:98340733-98340755 TCTCTCTGGTTCCAGGGTGGAGG - Intergenic
1072999273 10:100274372-100274394 TTGCTCTGGCAGCAGTGTGGAGG + Intronic
1074527682 10:114276225-114276247 GCCCTTTGGTGGGAGTGGGGAGG - Intronic
1074576416 10:114674000-114674022 ACCATCTGGTCCCAGTGTGGTGG + Intronic
1074851171 10:117440719-117440741 TCCCCCTGGTGGGAGTGCAGTGG + Intergenic
1074890777 10:117735223-117735245 ACCCTCTGGGCGCAGTGCGGTGG + Intergenic
1075291853 10:121237922-121237944 TCCATCAGGTGTCAGTGTGGTGG + Intergenic
1076183207 10:128426766-128426788 TCCCTCTGGCCGCTGCGTGGAGG - Intergenic
1076257553 10:129040224-129040246 TCCCCCTGGCAGCAGTTTGGAGG - Intergenic
1077061448 11:619489-619511 TCCCGCCTGTGCCAGTGTGGTGG + Exonic
1077354776 11:2110045-2110067 TCACTCTGGTGGCATTGAGTTGG + Intergenic
1077483305 11:2826644-2826666 TCCCTCTGGGAGCACAGTGGTGG - Intronic
1077783971 11:5362573-5362595 GTCTTCTGGTGGCAGAGTGGTGG + Intronic
1078665894 11:13324903-13324925 GCCAGCTGGTGGCAGTGTGGGGG + Intronic
1078749062 11:14142922-14142944 TGACACTGGGGGCAGTGTGGAGG - Intronic
1079153692 11:17924581-17924603 GCACTGTGGTGGCAGTGTGGAGG + Intronic
1080432839 11:32214489-32214511 TCCCTCTGCTTGCAGCATGGAGG + Intergenic
1080620199 11:33980927-33980949 TCACTCTGGCTGCTGTGTGGAGG - Intergenic
1080654112 11:34245259-34245281 TCGCCAGGGTGGCAGTGTGGTGG - Intronic
1081597980 11:44472395-44472417 TCCCTCAGGCTGGAGTGTGGTGG - Intergenic
1083647930 11:64183896-64183918 TCCCTCTGGCTGCTGTGTGGAGG - Intergenic
1084402091 11:68950473-68950495 TCCCTCTGGTGGCTGCCTTGAGG + Intergenic
1084545061 11:69811074-69811096 GCAGTCTGCTGGCAGTGTGGAGG + Intronic
1085282455 11:75340176-75340198 GCCCTCTGGGGGCAGTTTGCAGG + Intronic
1085644885 11:78216541-78216563 TCCCTCGGGTGCAAGTGTAGGGG - Exonic
1085799936 11:79580027-79580049 GCACTCTGGCAGCAGTGTGGAGG - Intergenic
1085838568 11:79983260-79983282 TCCTGCTGGTGGCACTGTGGTGG - Intergenic
1086181915 11:83962376-83962398 TCACTCTGGAGGGAGTTTGGGGG + Intronic
1086931326 11:92696252-92696274 TCCTCCTGTGGGCAGTGTGGAGG + Intronic
1088844480 11:113653214-113653236 TCACTCTGGCTACAGTGTGGAGG - Intergenic
1089376966 11:118001126-118001148 TCCCTCTGGAGGCAGGCTTGAGG + Exonic
1089687898 11:120168730-120168752 TCCCTCTGGCTGCTGGGTGGAGG - Intronic
1089770709 11:120800455-120800477 TCCCGCAGGTGGGGGTGTGGGGG + Intronic
1091776549 12:3188551-3188573 TTCCTCTGGCAGCAGTGTGGGGG + Intronic
1092534199 12:9372423-9372445 TCCCTCTTGTGGCAGACAGGAGG + Intergenic
1093180959 12:15966422-15966444 TCCCTCAGGTTGCAGTGCAGTGG - Intronic
1094063032 12:26334756-26334778 TGCATGTGGGGGCAGTGTGGTGG - Intergenic
1094322394 12:29199644-29199666 TCTCACTGGCAGCAGTGTGGAGG + Intronic
1094496607 12:30992892-30992914 ACCCCCTGGAAGCAGTGTGGTGG - Exonic
1095522820 12:43087145-43087167 TCCTTCTGGTGACTGTTTGGTGG - Intergenic
1095736055 12:45557339-45557361 TCCCACTGGGTGCAGAGTGGTGG - Intergenic
1096221598 12:49832711-49832733 TCCATGTGGTTGCAGTGAGGAGG + Intergenic
1097052367 12:56231054-56231076 TCCCGCAGGAGGCAGTGTGAAGG + Intronic
1097410716 12:59249197-59249219 TCCCTTTGGTGCCAGAGTAGTGG - Intergenic
1097699788 12:62808371-62808393 TCCCTCTGGTGGTAGGGTAGGGG - Intronic
1100690639 12:97035250-97035272 TCCATCTGATTGGAGTGTGGAGG + Intergenic
1101255852 12:102975819-102975841 TCACTTTGGTGGCAGTGGTGTGG - Intergenic
1101568068 12:105928256-105928278 TCATTCTGGTAGCACTGTGGAGG + Intergenic
1101866906 12:108527068-108527090 GCCCTCTGGAGGCAGTGGTGAGG - Intronic
1101937597 12:109070615-109070637 TTGCTCTGGTGGCAGTGTGAGGG + Intronic
1102311473 12:111848272-111848294 TCCTTCTGGTGGGTGTGTAGTGG + Intronic
1102607345 12:114078279-114078301 TCCCTCTGTTGGCAATTAGGTGG - Intergenic
1102745581 12:115246128-115246150 TGCATATGGTGGCAGGGTGGGGG - Intergenic
1103205487 12:119125556-119125578 ACCCTGTGCTGGAAGTGTGGAGG - Intronic
1103418263 12:120759351-120759373 GCCCCATGGTGGCTGTGTGGGGG + Intergenic
1103864044 12:124037332-124037354 TCTCTGTGGGGGCAGTTTGGGGG + Intronic
1103887793 12:124215900-124215922 TCCCTCTGGAGGCTCTGAGGAGG + Intronic
1104366235 12:128180293-128180315 TCCATTTGGAGGCAGGGTGGGGG + Intergenic
1104667699 12:130659012-130659034 TCCCTGTGCTGGCATGGTGGAGG - Intronic
1105763545 13:23535110-23535132 TTTCTCTGGTGGCATGGTGGGGG + Intergenic
1105777880 13:23679980-23680002 TCCTTCTGGGGACAGTGAGGAGG + Intergenic
1105925605 13:25004847-25004869 TCACTCTGGCTGCAATGTGGGGG - Intergenic
1105947520 13:25202462-25202484 TGCCTGTGGTGACAGTGTGGTGG - Intergenic
1106039097 13:26072813-26072835 TCACTCTGGCTGCAATGTGGGGG + Intergenic
1106998440 13:35515946-35515968 TCCTTCTGGTTGCAGAATGGTGG + Intronic
1108032709 13:46252991-46253013 TTATTCTAGTGGCAGTGTGGAGG + Intronic
1108530913 13:51326180-51326202 TGACTCTGGTGGCAGTGGGGTGG - Intergenic
1112329196 13:98463922-98463944 GCCATCAGGTGTCAGTGTGGCGG - Intronic
1112930631 13:104731979-104732001 TTCCTATGGTTGCAGAGTGGCGG - Intergenic
1115479393 14:33846301-33846323 GGTTTCTGGTGGCAGTGTGGAGG - Intergenic
1116417247 14:44693805-44693827 CCCCTCTGCTGCCAGTGTGCTGG - Intergenic
1117632624 14:57709302-57709324 GCCCTCTGGTGGCACTGTCCAGG + Intronic
1117728422 14:58696691-58696713 TCTCTCTGGTGGTGGTGTGATGG + Intergenic
1118041950 14:61926793-61926815 ACCCTCTACTGGCAGGGTGGGGG - Intergenic
1118646532 14:67846285-67846307 TCGTGCTGGTGGCAGTGTGGGGG + Intronic
1118884285 14:69853569-69853591 TTCCTCTGGAGGCAGGGTGTGGG + Intergenic
1119118926 14:72054728-72054750 TACCTCTGGTGGCAGAGGGATGG - Intronic
1119226732 14:72950168-72950190 TTCCTTTGGTGGCATTGTTGGGG + Intronic
1119330552 14:73790111-73790133 TCGCCCTGGCAGCAGTGTGGAGG - Intronic
1119694828 14:76704909-76704931 TCACTCTGGCGGCAGTGTGCTGG - Intergenic
1121129242 14:91430186-91430208 CCCCTCTGGTGGTACAGTGGTGG - Intergenic
1121157056 14:91695727-91695749 TCACTCTGGTGGGTGTATGGAGG + Intronic
1121312918 14:92944814-92944836 TGCCTCTGGGTGCAGTGGGGAGG - Intronic
1121818253 14:96944497-96944519 TCCCTCTGAAGGCATTGGGGAGG + Intergenic
1122231981 14:100310799-100310821 TCCCTCTGTTGCCAGGCTGGAGG - Intergenic
1122570244 14:102693516-102693538 TCCCACTGTTTGCAATGTGGAGG - Intronic
1122938907 14:104972539-104972561 TCCCTCTGGCTGCTGTGAGGTGG - Intronic
1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG + Intronic
1202890166 14_KI270722v1_random:148999-149021 GCCCTCTGGTGGCCGTGTCTGGG + Intergenic
1124011521 15:25843161-25843183 GCCCTCTGGTGCCAGGGAGGAGG - Intronic
1124714093 15:32042436-32042458 TCCCTCTGGTGGAAGGATGAGGG + Intronic
1124879436 15:33627747-33627769 TCCCACTGGTTGCAGTGTAGAGG + Intronic
1126845954 15:52760828-52760850 CCCCTCTGGTGGAGTTGTGGAGG + Intronic
1127313426 15:57772231-57772253 TGACTCTGGTGGCAAAGTGGAGG - Intronic
1127820937 15:62655539-62655561 CCTCTCCGGTGGCAGGGTGGAGG - Intronic
1128178584 15:65580041-65580063 ACCCTCTGATGCCACTGTGGTGG + Intronic
1128536080 15:68491734-68491756 TCCCTCTGCAGGCAGTGTGGAGG + Intergenic
1128786795 15:70403542-70403564 TCCATATGGTGACAGTGTGGGGG - Intergenic
1129795789 15:78374993-78375015 TCACTCTGGCTGAAGTGTGGAGG + Intergenic
1130182383 15:81643607-81643629 GTCTCCTGGTGGCAGTGTGGTGG + Intergenic
1130891221 15:88135529-88135551 CCCCTCTGCTGGGATTGTGGTGG - Intronic
1131158992 15:90092232-90092254 TTCCACGGGTGGCAGGGTGGTGG - Intronic
1131225921 15:90624336-90624358 TCACTGTGGTTCCAGTGTGGAGG - Intronic
1131819797 15:96260743-96260765 TGCCTGTGTTGGCAGTTTGGTGG - Intergenic
1131996985 15:98142759-98142781 TCCCCCTGGTGGTAGTGGGGAGG - Intergenic
1132587486 16:711880-711902 GCCCTCTGGTGGCGGCGTGAGGG - Intronic
1132623411 16:878980-879002 CCCCCCTGGAGGCAGCGTGGGGG + Intronic
1133768617 16:8854885-8854907 GCCCACTGGTGGCTGAGTGGAGG - Exonic
1134689745 16:16183431-16183453 TCCCTCTGGTCACTGGGTGGAGG - Intronic
1135631197 16:24036851-24036873 TCCCTCTGGTGTCATTCTGTGGG + Intronic
1135828982 16:25756318-25756340 TCACTCTGGTGGCAGTGAGGAGG + Intronic
1136557741 16:31018069-31018091 TCCTGCTGGTGGCCGTGTGCGGG + Intergenic
1137373132 16:47927399-47927421 TTCATCTGGTGGAGGTGTGGGGG - Intergenic
1137444524 16:48523645-48523667 TCCCCTTGGTGACATTGTGGTGG - Intergenic
1137711883 16:50572296-50572318 CCCCTCTGGTGGCAGGGGGCAGG + Intronic
1138190348 16:55009281-55009303 TCCCTCTGTTTGCAGTGCTGGGG - Intergenic
1138480987 16:57303401-57303423 TCCCTTTGGCTGCTGTGTGGAGG + Intergenic
1139383518 16:66549562-66549584 ACACTCTGGTGCCAGCGTGGGGG - Intronic
1139776458 16:69319800-69319822 TCCCTGTTGGGGCAGTGTGTGGG + Intronic
1140036161 16:71372791-71372813 TCCCCCTGGTGGGAGACTGGGGG + Intronic
1140186601 16:72778678-72778700 TCCCTTTGGGGGCAGGGTGGGGG + Intergenic
1142480530 17:215788-215810 TCCCACAGGTGGCAGCGTGGAGG - Exonic
1142672824 17:1495068-1495090 TTCCTCAGATGGCAGGGTGGAGG + Exonic
1143283748 17:5773930-5773952 TGTCTCTGCTGGCAGCGTGGGGG + Intronic
1143608507 17:8004075-8004097 TCCCTCTGAAGGCAGCGTGCTGG + Exonic
1143731045 17:8882951-8882973 TCCCTCTGGCAGCTCTGTGGAGG - Intronic
1144146425 17:12403779-12403801 TGCAGCTGGTGGGAGTGTGGGGG - Intergenic
1144161694 17:12566458-12566480 TCCCTCTGGGGGTAGTGAGAGGG - Intergenic
1144766888 17:17737971-17737993 TCCTTCTGGGGCCAGGGTGGGGG - Intronic
1144882726 17:18438914-18438936 TTCTTCTGCTGGGAGTGTGGGGG + Intergenic
1145952228 17:28827856-28827878 TCATTCTTGTGGCAGTGTGGTGG + Intronic
1146401749 17:32505101-32505123 TCTCTCTGATGACTGTGTGGAGG - Intronic
1146469816 17:33115168-33115190 TTCTTCTGGGGGCAGTGTGCTGG + Intronic
1147161225 17:38570583-38570605 TGACACTGGTGGCAGGGTGGGGG - Intronic
1147176913 17:38661590-38661612 TCTCTCTGGGTGGAGTGTGGTGG + Intergenic
1147181761 17:38690968-38690990 TCCCCTGGGAGGCAGTGTGGAGG + Intergenic
1147899642 17:43775695-43775717 TCCCTCTGGGGGCAGGGAGGGGG - Intronic
1148743203 17:49904418-49904440 TCCCTCTTGGTGCAGTGTGGAGG - Intergenic
1151158149 17:72141941-72141963 TCCCCCTGGCTGGAGTGTGGTGG + Intergenic
1151833767 17:76570314-76570336 GCCCTCTGGGGGCAGTGGGCTGG - Intronic
1152294766 17:79460389-79460411 TGACTGTGGTGGGAGTGTGGTGG - Intronic
1155489202 18:26382488-26382510 TCCATCTAGTAGCAGTTTGGTGG + Intronic
1157334604 18:46728853-46728875 TCACTCTGATGGCAGTGTTCAGG - Intronic
1157526187 18:48384353-48384375 TCCCTCAGTTCCCAGTGTGGTGG - Intronic
1158504640 18:58035666-58035688 TTCCTCGGCTGGCATTGTGGTGG + Intergenic
1160861118 19:1237593-1237615 TCCCTCTGGAGGCAGCCGGGTGG + Intronic
1160940468 19:1618360-1618382 ACCCTCTGGTGGCTGCTTGGAGG - Intronic
1160988470 19:1851044-1851066 ACCCTCTGGTGGCCGTGGGGAGG + Intergenic
1161028120 19:2045998-2046020 CCCCTCTGGTACCAGGGTGGGGG - Intronic
1161317150 19:3622634-3622656 TCCCTCTGGGGGCCGAGGGGAGG - Intronic
1161457311 19:4375872-4375894 TCCCACTGGGGGCAGCATGGAGG + Intronic
1161493685 19:4576166-4576188 GCCCTCTGGTGGCAGCTTTGGGG - Intergenic
1162924601 19:13923852-13923874 GCCCTTTGGTGGCGGTGGGGCGG + Intronic
1163632028 19:18422374-18422396 TCCCTCAGCTGCCAGTGGGGAGG + Intronic
1164063164 19:21692801-21692823 TCCCTCCGGTAGCAGTGTACAGG + Intergenic
1166083318 19:40458493-40458515 CCCCTCTGATGGCAGCCTGGAGG + Exonic
1166234859 19:41448152-41448174 TCCCTCTGGCTGCCGCGTGGAGG + Intergenic
1166678921 19:44755949-44755971 TCCCTCTGGCTGTTGTGTGGGGG + Intronic
1166695981 19:44851597-44851619 TTCCTGTGGTGGCAGAGTGGAGG - Intronic
1167150660 19:47707474-47707496 ACCCTCTGGTGGCTGTTTGCGGG + Intergenic
1167324269 19:48814153-48814175 TCACCCAGGTTGCAGTGTGGTGG - Intronic
1167538530 19:50070858-50070880 TCCCCATGGTGGTATTGTGGAGG + Intergenic
1167583272 19:50358882-50358904 TCCCTGTGATGGCAGTTTGTTGG - Intronic
1168156018 19:54473250-54473272 CCCCTCTGGGCGGAGTGTGGGGG + Exonic
926248740 2:11140947-11140969 TTAGTCTGGTGGCAATGTGGAGG - Intronic
926265271 2:11311310-11311332 TCCTTGAGGTGGCAGGGTGGTGG + Intronic
926405087 2:12543299-12543321 TCCCTGAGCTGGCAGTGTAGTGG + Intergenic
926600222 2:14834871-14834893 ACTCTCTGGTGACAGTATGGAGG + Intergenic
927760182 2:25745526-25745548 TCCCTCTGGAGTCACTGTGTTGG - Intronic
930707550 2:54519731-54519753 TCCCTCTGGTAGCATTGTAGGGG + Intronic
930710059 2:54542612-54542634 TCCCTCTGGGGACACTGTGAAGG + Intronic
932223819 2:70023181-70023203 TCCCACATGTGGCAGTGGGGAGG - Intergenic
932816201 2:74864175-74864197 TGGCTCTAGTGGCACTGTGGAGG - Intronic
936383093 2:112004959-112004981 TCACTTTGATGTCAGTGTGGAGG + Intronic
937467418 2:122146729-122146751 TCACTCTGGCTGCAGTGTGGAGG + Intergenic
939529788 2:143343554-143343576 TCACTGTGTTGGCAGTGTGGGGG + Intronic
940288552 2:152055985-152056007 TCCTTCTGGCTTCAGTGTGGTGG - Intronic
941978397 2:171430629-171430651 TCACTCTGGCAGCAGTATGGAGG + Intronic
942147315 2:173039578-173039600 TCCCTGTGGTTGGAGTGTGGAGG - Intronic
942781234 2:179646091-179646113 TCACTCTGGCAGCATTGTGGAGG - Intronic
943538505 2:189182518-189182540 TCCTCCTGGGGACAGTGTGGTGG - Intergenic
943586870 2:189751266-189751288 GCCCCCTTGTGGCAGTGTTGAGG - Intronic
944134404 2:196382974-196382996 TGGCTCTGGTGGCAGTATGGGGG + Intronic
944465026 2:199992445-199992467 TCCCTTTGCTTGCTGTGTGGAGG - Intronic
944608731 2:201378264-201378286 TCACTTTGGAGGCAGGGTGGTGG - Exonic
945838881 2:214865255-214865277 GCTCTCTGGTGGCTATGTGGAGG + Intergenic
947469883 2:230391697-230391719 TGGCTCTGGAGGCAATGTGGAGG - Intronic
947598001 2:231426116-231426138 TCCCTCTGTGGGCAGGGTGATGG - Intergenic
948225809 2:236308556-236308578 GCCCTCTGTGGCCAGTGTGGGGG + Intergenic
948261351 2:236606523-236606545 CCACTCTGGTGGCATTGTGGAGG - Intergenic
949016305 2:241713408-241713430 TCCCTCAGGCTGGAGTGTGGTGG + Intronic
949055783 2:241927689-241927711 TCCCTCTGCTGTGAGTGGGGTGG - Intergenic
949055802 2:241927778-241927800 TCCCTCTGCTGTGAGTGGGGTGG - Intergenic
949055897 2:241928163-241928185 TCCCTCTGCTGTGAGTGGGGTGG - Intergenic
949055940 2:241928312-241928334 TCCCTCTGCTGTGAGTGGGGTGG - Intergenic
949056050 2:241928725-241928747 TCCCTCTGCTGTGAGTGGGGTGG - Intergenic
949056218 2:241929340-241929362 TCCCTCTGCTGTGAGTGGGGTGG - Intergenic
949056265 2:241929514-241929536 TCCCTCTGCTGTGAGTGGGGTGG - Intergenic
1169001653 20:2172290-2172312 TCCTTCTGGTCTCAGTATGGAGG + Intronic
1169110345 20:3028824-3028846 TCCCTCTGGCAGCAGTGAGAAGG + Intronic
1169512967 20:6284787-6284809 GCCATTTGGTGGCCGTGTGGTGG + Intergenic
1170235058 20:14094064-14094086 TCCCTTTGGCTGCAGTGTGAAGG + Intronic
1170261004 20:14408406-14408428 TTCCTTGGGTGGCAGTGTGGAGG + Intronic
1170562221 20:17568276-17568298 TAACTCTGGTGGCAGAGTGGAGG + Intronic
1170606559 20:17879011-17879033 TGCCGCAGGGGGCAGTGTGGGGG + Intergenic
1171158559 20:22899649-22899671 TCCCTTCAGTGGCAGTATGGGGG - Intergenic
1173362811 20:42359809-42359831 TCCCTGTGCTGGCAGTGCTGGGG - Intronic
1174079775 20:47962643-47962665 TCCCTCTGCTGGGAGGGGGGAGG + Intergenic
1174587335 20:51619159-51619181 TGCCTCTGGTGGCAGGGGAGGGG - Intronic
1175444921 20:59013370-59013392 TCCCTCTGGTGACTGTGGGAAGG + Intergenic
1175996423 20:62814116-62814138 TGCCTGTGGGGGCAGAGTGGTGG + Intergenic
1176020924 20:62962019-62962041 TCCCCCTGGTGCCAGTGGAGGGG + Intronic
1176245083 20:64093598-64093620 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245091 20:64093621-64093643 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245135 20:64093772-64093794 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245147 20:64093807-64093829 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245176 20:64093890-64093912 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245209 20:64093985-64094007 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245221 20:64094021-64094043 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245320 20:64094313-64094335 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245330 20:64094347-64094369 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245366 20:64094463-64094485 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245384 20:64094510-64094532 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1179500992 21:41808491-41808513 TGCCTCAGGTGTCAGTCTGGTGG - Intronic
1179806895 21:43845094-43845116 GCCCTCTGGTGGAAATGTTGGGG - Intergenic
1180027105 21:45172211-45172233 TCTCTCTGGTGCCGGGGTGGTGG + Intronic
1181465152 22:23106925-23106947 TCCCTGTGTGTGCAGTGTGGAGG - Intronic
1181876301 22:25943395-25943417 TCCCTCTGGCTGCTGTGGGGAGG - Intronic
1182350420 22:29696111-29696133 TCACCCAGGTGGGAGTGTGGTGG + Exonic
1182409246 22:30168839-30168861 TCCCTATGGCAGCAGTGTGAAGG - Intronic
1183021796 22:35033405-35033427 TCACTCTGGTGGCTGTATTGAGG + Intergenic
1183031291 22:35108368-35108390 TACCTTGGGTGTCAGTGTGGGGG - Intergenic
1183190248 22:36317841-36317863 TCCTTCTGGTGCCAGGGTGGCGG - Intronic
1183369227 22:37423120-37423142 TCCCCCGGGTGACAGTGGGGAGG - Intronic
1183599954 22:38834220-38834242 TGCCTCTGGCCGCTGTGTGGAGG - Intronic
1184153556 22:42652159-42652181 GAACTCTGGGGGCAGTGTGGAGG + Intergenic
951269190 3:20603863-20603885 TTACTCTGGCGGCAATGTGGAGG + Intergenic
954168717 3:48782153-48782175 TCTGGCTGGTGGCAGTGAGGTGG - Intronic
954885549 3:53870268-53870290 TTCCCCTGGCTGCAGTGTGGAGG - Intronic
954896103 3:53976274-53976296 TGGCTCTGGCGGCAGTATGGAGG + Intergenic
955374166 3:58380391-58380413 TCACTCAGGCTGCAGTGTGGTGG - Intronic
957090318 3:75723675-75723697 GCCCTCTGGTGGCTGTGTCCGGG - Intronic
961088145 3:124087707-124087729 TTCCTCTGGTGGCTGGGAGGGGG + Intronic
961930346 3:130526522-130526544 TCCCTCTGATTGCTGTGTGAAGG + Intergenic
962378175 3:134875907-134875929 TCCCTCTGGCAGCTGAGTGGAGG - Intronic
963341500 3:144040049-144040071 TCACTCTGGTTGCAGTGTCAAGG - Intronic
963637117 3:147811794-147811816 TCATTCTGGTGACAGTGTGTAGG + Intergenic
963895906 3:150684635-150684657 CCACTCTAGCGGCAGTGTGGTGG + Intronic
963952111 3:151214281-151214303 TTCATCTGGAGGCTGTGTGGAGG + Exonic
964524774 3:157606756-157606778 TCCCCCTGGTGACAGCGTGTGGG - Intronic
965439833 3:168699095-168699117 TCCCTCTGGTGGCCCTGTCTGGG + Intergenic
965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG + Intronic
965759461 3:172060322-172060344 TCCCTCAGGTGAGAGTGTAGTGG + Intronic
966252961 3:177887452-177887474 TCTCTGTGGTGGCAGAGTGGAGG - Intergenic
966763183 3:183435095-183435117 TCCCTCAGATGGCAGTAAGGAGG - Intergenic
967878201 3:194281004-194281026 TCCCTGGGGTGCCTGTGTGGAGG + Intergenic
967948978 3:194825630-194825652 TCCCCCAGGAGGCAGTGTTGAGG - Intergenic
969131396 4:4993432-4993454 TTGCTCTGGTTGCTGTGTGGAGG - Intergenic
969278794 4:6155087-6155109 TACTTCTGGTGACAGTGTTGGGG + Intronic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
970628981 4:17921054-17921076 TCACTCTGTTGCCAGGGTGGAGG + Intronic
971126333 4:23759275-23759297 TCACTCTGGCCACAGTGTGGAGG - Intronic
971306630 4:25488173-25488195 TCCCTCTGGCTGCAGTGTGGAGG + Intergenic
972118306 4:35666899-35666921 TCCCTCTGGCTGCGGTGTGTGGG - Intergenic
973201952 4:47513810-47513832 TCACTATGGAAGCAGTGTGGTGG + Intronic
973598553 4:52517812-52517834 CCATTCTGGTGGCTGTGTGGTGG - Intergenic
976172874 4:82322789-82322811 TCACTCTGGTGCCAGTGTGGAGG - Intergenic
976249426 4:83035139-83035161 TCCCTCTGGCTGCACTCTGGAGG + Exonic
976297311 4:83485128-83485150 ACCCTGTGGTGGCAGCGAGGCGG + Exonic
977318927 4:95486605-95486627 TAACTCTGGTAGCAGTTTGGAGG - Intronic
977536219 4:98259692-98259714 TCCCTCTGAGGGCACTGGGGAGG - Intergenic
977719893 4:100227583-100227605 TATCTCTGGTGGCAGTGTTATGG + Intergenic
979363636 4:119794455-119794477 TAACTCTGGTGGCAGTGTGTAGG + Intergenic
979635838 4:122953586-122953608 TCCCTCTGCAGGAAGGGTGGCGG + Intronic
980489328 4:133505454-133505476 TCCCTTGGGTGGCAGATTGGGGG - Intergenic
981281884 4:142967855-142967877 TCCCTCTGGCGTCTGTGTGTTGG - Intergenic
981335047 4:143560018-143560040 GCTCCCTGGTGGCAGGGTGGAGG - Intergenic
981881128 4:149614123-149614145 TCCCCTTGGTGGGAGTGTTGAGG + Intergenic
984461449 4:180041736-180041758 TACCTGTGCTGGCAATGTGGTGG - Intergenic
985817593 5:2138076-2138098 TCACCCTGCTGGCAGGGTGGGGG + Intergenic
985821958 5:2166546-2166568 TGACTGTGGTGGGAGTGTGGGGG + Intergenic
990347243 5:54883107-54883129 TTCCCCTTGTGGCAGTGGGGAGG - Intergenic
991184530 5:63792034-63792056 TCTCTTAGGTGGCACTGTGGAGG + Intergenic
991914122 5:71588993-71589015 TCAGTGTGGTGGCAATGTGGAGG + Intronic
992367230 5:76105225-76105247 TCCCTCTGGAGGCTTTGAGGAGG - Intronic
993233698 5:85274664-85274686 TCCCTCAGGTTGGAGTGTAGTGG + Intergenic
994383209 5:99096492-99096514 TCCTTCTGGTGGCTGTAGGGGGG + Intergenic
995438729 5:112166216-112166238 GAACTCTGGTGGCATTGTGGTGG + Intronic
996412624 5:123175101-123175123 TCCCATTGGGGGCAGTATGGTGG + Intronic
997394257 5:133545244-133545266 TCCCTGGTGTGGCAGTGTTGGGG + Intronic
997589880 5:135066111-135066133 TCTCCCAGGTGGCAGTGTGTGGG + Intronic
997607424 5:135185175-135185197 TCCTTTTGGGGGCAGTTTGGAGG + Intronic
998906355 5:146909244-146909266 TCCCTCTGATGTTAGTGTGGGGG - Intronic
999325160 5:150639268-150639290 TCTCTCTGCTGGCAGTGGGTCGG - Intronic
1000131536 5:158304901-158304923 TCCCTCTGAGGCCAGTGTGTTGG + Intergenic
1000541039 5:162540347-162540369 TCCCTCTGGCTGCTGAGTGGAGG + Intergenic
1000923759 5:167169173-167169195 TTCCTCTGGTGGCAGAGGAGTGG + Intergenic
1001019467 5:168170734-168170756 TCCCTCTGGCTGCTGTGTGGAGG - Intronic
1001136408 5:169106290-169106312 TCCCTCTGGCTGCAGTTTGGAGG + Intronic
1001188251 5:169599570-169599592 TGCCTCTGATGGAAGTCTGGAGG + Intronic
1002060272 5:176621562-176621584 TCCAAATGGTGGAAGTGTGGAGG - Intronic
1002294606 5:178223397-178223419 TCACCCTGGTGGCCATGTGGAGG - Intronic
1003003334 6:2357899-2357921 TCTCTCTGTTGGCTTTGTGGAGG - Intergenic
1006347608 6:33495796-33495818 TCCCTCTGTTGCCAGGCTGGAGG + Intergenic
1006432666 6:34007540-34007562 TCCCTCTGACTGCTGTGTGGGGG + Intergenic
1006674935 6:35755919-35755941 TCCCTCTGATGGGATTGTGATGG + Intergenic
1007057493 6:38902327-38902349 TCTATCTGGTGGGTGTGTGGTGG + Intronic
1007090033 6:39178360-39178382 TCCCTGTGGTGGGAGAGCGGTGG - Intergenic
1007179708 6:39921040-39921062 TACCTTAGGTGGCAGTGGGGTGG + Intronic
1007517704 6:42426383-42426405 ACCCACTGGTGTCTGTGTGGGGG - Intronic
1008809196 6:55472309-55472331 CCAGTCTGGTGGCTGTGTGGTGG + Intronic
1011058544 6:83234724-83234746 TTACTCTGATGGCATTGTGGAGG - Intronic
1011501062 6:87990651-87990673 TCCTTTTGGCAGCAGTGTGGAGG + Intergenic
1011783956 6:90823111-90823133 TCCCTCTGGTGGGTGTGGGAAGG - Intergenic
1011797928 6:90978033-90978055 TCCTTCTGGAGGCTGTGGGGAGG - Intergenic
1012448941 6:99334702-99334724 TCCCTCTGGTGGCAGTGTGGAGG - Intronic
1013017995 6:106178613-106178635 TGACTCTGGTGGCAGTGTGCAGG - Intergenic
1013622065 6:111899582-111899604 GCAGTCTGGTGGCAGTGGGGAGG + Intergenic
1015633299 6:135252405-135252427 TCACTTTGGTGGCAGGGTGGTGG - Intergenic
1017781842 6:157721476-157721498 TCACTCTGGCCGCAGTGTGGAGG - Intronic
1019216563 6:170447619-170447641 TCCTTGTGGAGTCAGTGTGGAGG - Intergenic
1019256777 7:57397-57419 TGCCTATGGGGGCTGTGTGGAGG - Intergenic
1019258711 7:67879-67901 TTCACCAGGTGGCAGTGTGGTGG + Intergenic
1019564092 7:1671019-1671041 TCCCTCTGGGGGCTGGGAGGAGG + Intergenic
1020750532 7:12135307-12135329 CCCCTCTGGTTGCTATGTGGAGG - Intergenic
1022870273 7:34471327-34471349 TCCCAGTGGTGGCAGTGGGCAGG + Intergenic
1022988589 7:35685202-35685224 TCCCTCTGTTGCCAGGTTGGAGG - Intronic
1023696511 7:42853122-42853144 TCCCTCCTCTGGCAGTGGGGTGG - Intergenic
1024550802 7:50561197-50561219 TCCCCCTGGGGGCAGAGTGGGGG - Intronic
1026052836 7:66961337-66961359 TCCCTCTGGCAGCAGCCTGGGGG - Intergenic
1026461853 7:70621300-70621322 TCACTGTGGGGGCAGGGTGGGGG + Intronic
1028730885 7:94147038-94147060 TCCTTCTGGAAGCAGTGTAGAGG - Intergenic
1030080825 7:105776278-105776300 TCCCTCTGTGAGCAGTGGGGAGG - Intronic
1032557768 7:132855643-132855665 TCCCTCAGAAGGCAGTGTGCAGG + Intronic
1033348137 7:140541264-140541286 TCCCCCTGGAGGGAGTCTGGGGG + Intronic
1034918370 7:155059418-155059440 TGGCTCTGGTGGAACTGTGGTGG - Intergenic
1036148807 8:6279418-6279440 AACCTTTGGTGGAAGTGTGGGGG - Intergenic
1036422834 8:8613924-8613946 TGGCTCTGGTGCCATTGTGGAGG - Intergenic
1036617527 8:10400178-10400200 TCACTCTGGAGGAATTGTGGAGG + Intronic
1037057189 8:14457291-14457313 GCCCTCTGGTGGCCCTGTGTGGG - Intronic
1037658491 8:20907462-20907484 TCCTACTGGTGTCAGTGGGGAGG - Intergenic
1037928510 8:22863999-22864021 TCATTCTGGTGGCTGTGAGGAGG - Intronic
1038772812 8:30499262-30499284 TCCGTCTGGTGGCAGCAGGGAGG + Intronic
1039517208 8:38144159-38144181 TCCATCTGGTGACAGTGGGATGG - Exonic
1039909034 8:41809725-41809747 TCACTCGGGTTGAAGTGTGGTGG - Intronic
1040597398 8:48852842-48852864 CCCCTCTGCTGTCAGTTTGGGGG - Intergenic
1041046254 8:53889228-53889250 TCATTCTGGTGGCTGTGTAGTGG + Intronic
1043137607 8:76548177-76548199 ACCCTATGGTGGCAGTTTTGAGG - Intergenic
1044471578 8:92575344-92575366 GAACTCTGTTGGCAGTGTGGAGG - Intergenic
1044527441 8:93267523-93267545 TCCCACTGGTGTGAGTCTGGAGG - Intergenic
1044578281 8:93795084-93795106 TAACTCTGGTGGTAGTGTGGAGG + Intronic
1044880943 8:96721605-96721627 TCACTCTGGAGGTAGTATGGAGG - Intronic
1045215852 8:100147602-100147624 CCACTCTGGTGGCAGAATGGAGG + Intergenic
1047753260 8:127898705-127898727 TCCCTGTGGTGGGGGTGAGGCGG + Intergenic
1048451908 8:134540972-134540994 CCCCTCTGGTGCCAGTGGGCAGG - Intronic
1049470775 8:142774175-142774197 ACCCTCTCGTGGCCGTGCGGGGG - Intronic
1049535991 8:143182423-143182445 TCCCTTTGGTAGTAGTGAGGTGG - Intergenic
1050062751 9:1727545-1727567 TCCCTCTGGTGGTAATGTGGTGG - Intergenic
1050694312 9:8261859-8261881 TCTCTGTGGAGGCAGTGGGGTGG + Intergenic
1051784656 9:20729224-20729246 TCCTTCTGGAGGCTCTGTGGGGG + Intronic
1052692207 9:31829112-31829134 TCACTCTGGCTGCAGTGTGGAGG - Intergenic
1053223039 9:36327309-36327331 TCCCTCTGGAGGCTGTGCAGAGG + Intergenic
1057152578 9:92808464-92808486 TCCCTCCGGTGGAGGAGTGGGGG + Intergenic
1057931873 9:99200666-99200688 TCCCCCATGTGGCAGGGTGGGGG - Intergenic
1057994147 9:99804805-99804827 TCCCTCTGGAGGCTCTTTGGGGG - Intergenic
1058237770 9:102514337-102514359 TCCTTCTGGTGGCAAGGAGGGGG - Intergenic
1058504259 9:105652941-105652963 TCATTCTGGTGGCAGTATAGAGG - Intergenic
1058840444 9:108902362-108902384 TCCCTTTGTTGGGAGTGTGATGG - Intronic
1059348122 9:113646119-113646141 TCCCTCTGGCAGCTGGGTGGAGG + Intergenic
1059525464 9:114987391-114987413 TCACTCTGGCTGCAGTGTGGAGG - Intergenic
1059542349 9:115143672-115143694 TCACTTTGGTGGGAGTATGGAGG - Intronic
1059661324 9:116404646-116404668 TCCCTCGGGTGGCAGTGTGAAGG + Intergenic
1060591968 9:124822907-124822929 TCACCCAGGTGGGAGTGTGGTGG - Intergenic
1060857497 9:126926681-126926703 TAGTCCTGGTGGCAGTGTGGAGG + Intronic
1060960248 9:127675753-127675775 TCTCTCTGGTGACAGTGTGGAGG - Intronic
1061039255 9:128130167-128130189 GCCCTCTGGTGGCCCTGTGTGGG + Intergenic
1061237010 9:129349176-129349198 GACCCCAGGTGGCAGTGTGGTGG + Intergenic
1062006123 9:134239442-134239464 TCCCACTGGGGGCAGGGTGTGGG - Intergenic
1062464658 9:136675704-136675726 TCCCTTTGGGGGCAGAGTGAGGG - Intronic
1186650916 X:11559143-11559165 GCCCCCTGGTGGCTGGGTGGTGG + Intronic
1186909488 X:14146760-14146782 TCCCTCTGGCAGCACTGTGAAGG + Intergenic
1187206153 X:17183687-17183709 TCCCTCTGGCTGCAGGGTGGAGG - Intergenic
1187832863 X:23400443-23400465 TCACTCTGTTGCCAGTCTGGAGG - Exonic
1189501091 X:41559843-41559865 TCCCTCTGGAGGGGGGGTGGTGG + Exonic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191105337 X:56768822-56768844 TCGCACTGGGGGCAGTGTGAGGG + Intergenic
1191106330 X:56774224-56774246 TCGCACTGGGGGCAGTGTGAGGG + Intergenic
1191107323 X:56779626-56779648 TCGCACTGGGGGCAGTGTGAGGG + Intergenic
1193961783 X:87935187-87935209 TCCCTGTGGAGGCACTGTGTAGG + Intergenic
1194185082 X:90765636-90765658 TCCCTCTGCTTGCCGTGAGGTGG + Intergenic
1195000486 X:100638713-100638735 TCGGTTTGGTGGCATTGTGGGGG - Intronic
1195081620 X:101376723-101376745 TTCCTCTGGTGGGGGGGTGGGGG + Intronic
1195272959 X:103251113-103251135 ACCCTCTGGGGGCTGTGCGGAGG + Intergenic
1195376921 X:104236882-104236904 TCGCTCAGGTTGGAGTGTGGTGG - Intergenic
1196666853 X:118326157-118326179 TCACTCTGGTGGCAGTATTAAGG - Intergenic
1196795072 X:119495787-119495809 GCCCTCTAGAGGCAGAGTGGGGG - Intergenic
1197316123 X:124967849-124967871 TGACCCTAGTGGCAGTGTGGAGG - Intergenic
1197542006 X:127775722-127775744 TCACCCAGGTGGGAGTGTGGTGG - Intergenic
1198037297 X:132813830-132813852 TTTCTCTAGTGGCAGTGTAGGGG - Intronic
1199596801 X:149512429-149512451 TCCCTCTGCTGGCTGTTTGTGGG - Intronic
1200288933 X:154852832-154852854 TCGCTCAGGCTGCAGTGTGGTGG - Intronic
1200531706 Y:4347747-4347769 TCCCTCTGCTTGCCGTGAGGTGG + Intergenic
1200977970 Y:9232902-9232924 TGGCCCAGGTGGCAGTGTGGTGG - Intergenic