ID: 1012455096

View in Genome Browser
Species Human (GRCh38)
Location 6:99394647-99394669
Sequence GTTCGAAGTTGACCTCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012455094_1012455096 -10 Left 1012455094 6:99394634-99394656 CCTCAAACCTCATGTTCGAAGTT No data
Right 1012455096 6:99394647-99394669 GTTCGAAGTTGACCTCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012455096 Original CRISPR GTTCGAAGTTGACCTCAATC AGG Intergenic
No off target data available for this crispr