ID: 1012455186

View in Genome Browser
Species Human (GRCh38)
Location 6:99395477-99395499
Sequence TATTGACCTCCTCCTAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012455182_1012455186 18 Left 1012455182 6:99395436-99395458 CCAGACAGCAATAGTCTTTCATT No data
Right 1012455186 6:99395477-99395499 TATTGACCTCCTCCTAAGGGTGG No data
1012455181_1012455186 19 Left 1012455181 6:99395435-99395457 CCCAGACAGCAATAGTCTTTCAT No data
Right 1012455186 6:99395477-99395499 TATTGACCTCCTCCTAAGGGTGG No data
1012455180_1012455186 24 Left 1012455180 6:99395430-99395452 CCTCACCCAGACAGCAATAGTCT No data
Right 1012455186 6:99395477-99395499 TATTGACCTCCTCCTAAGGGTGG No data
1012455179_1012455186 27 Left 1012455179 6:99395427-99395449 CCACCTCACCCAGACAGCAATAG No data
Right 1012455186 6:99395477-99395499 TATTGACCTCCTCCTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012455186 Original CRISPR TATTGACCTCCTCCTAAGGG TGG Intergenic
No off target data available for this crispr