ID: 1012456250

View in Genome Browser
Species Human (GRCh38)
Location 6:99409250-99409272
Sequence CTTCGATTCTGGGGAGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012456243_1012456250 0 Left 1012456243 6:99409227-99409249 CCCTGAATGATGATGGCCTTTCT 0: 1
1: 0
2: 1
3: 17
4: 159
Right 1012456250 6:99409250-99409272 CTTCGATTCTGGGGAGGTGCTGG 0: 1
1: 0
2: 1
3: 5
4: 118
1012456244_1012456250 -1 Left 1012456244 6:99409228-99409250 CCTGAATGATGATGGCCTTTCTC 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1012456250 6:99409250-99409272 CTTCGATTCTGGGGAGGTGCTGG 0: 1
1: 0
2: 1
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012456250 Original CRISPR CTTCGATTCTGGGGAGGTGC TGG Exonic
900624054 1:3600152-3600174 CCTGGGTTCTGGGGAGATGCAGG - Intronic
900640249 1:3685010-3685032 CCTCCAATCTGGGGAGGGGCAGG + Intronic
906595030 1:47068442-47068464 CGAAGATTCTGTGGAGGTGCTGG + Intronic
909167539 1:72247911-72247933 CTTGGATTCTGGGGAGGCATCGG + Intronic
911864383 1:102998064-102998086 ATGAGATTCTGGGGAGGTTCTGG + Intronic
917821513 1:178768655-178768677 CCTCAGTCCTGGGGAGGTGCTGG + Intronic
922254029 1:223875967-223875989 TTTTGAATCTGGGGAGATGCTGG + Intergenic
922738949 1:228005119-228005141 CCTCATTTCTGGGGAGGTGGGGG + Intergenic
1063377478 10:5562619-5562641 CTTCGGTTCTGGGGTGGAGATGG - Intergenic
1064034694 10:11905882-11905904 GTTCAATTCTGGGTTGGTGCAGG - Intergenic
1064672477 10:17730975-17730997 CACCGCTTCTGGGGAGGTGGAGG - Intergenic
1068238021 10:54263662-54263684 CTTCATTTCTGGGTAGTTGCAGG - Intronic
1069111739 10:64456075-64456097 CTTCATTTCTGGGGTTGTGCTGG - Intergenic
1072591097 10:96829476-96829498 CTTACATTCTAGGGAGGGGCAGG - Intergenic
1073057092 10:100709917-100709939 CTTCGAAACTGGGGAGGGGGAGG - Intergenic
1073143602 10:101264806-101264828 CTCCCCTTCTGGGGAGCTGCTGG - Intergenic
1074777287 10:116775648-116775670 CTCGGATGCTGGGAAGGTGCTGG + Intergenic
1075583746 10:123642662-123642684 CCTCAATGATGGGGAGGTGCTGG + Intergenic
1078040356 11:7855867-7855889 CTGAGATTCTGTGGAGATGCTGG + Intergenic
1083324654 11:61867092-61867114 CTTAGATTCAGGGGAAGGGCAGG + Exonic
1083652188 11:64210229-64210251 CTTGCATTCTGGGGAGCTCCTGG - Intronic
1083861034 11:65420101-65420123 CTTGGATTCCGGGGTGGAGCTGG - Intergenic
1085521673 11:77142780-77142802 CTGCGACTCTGGGCAGGTCCAGG + Exonic
1099518609 12:83630329-83630351 CTTCTATTGTGGGGAGGAGAGGG + Intergenic
1102962026 12:117099246-117099268 CTCCGCGTCTGAGGAGGTGCGGG - Exonic
1104591010 12:130084697-130084719 CTACATTTCTGGGAAGGTGCTGG + Intergenic
1104735484 12:131133583-131133605 CGTCCCTTCCGGGGAGGTGCAGG + Intronic
1105672785 13:22638787-22638809 CTTTGATTCAGGTGAGGTGAGGG + Intergenic
1113664428 13:112131518-112131540 CAGCGATTCTGGGCAGGTCCTGG + Intergenic
1117343071 14:54808122-54808144 CCTTGATTCCGGGGAGGAGCAGG - Intergenic
1119658096 14:76431838-76431860 CTTGTGTTCTGGGGAGGAGCGGG - Intronic
1121262052 14:92573541-92573563 CTTAGATTCAAGGGAGGTGCTGG - Intronic
1122980663 14:105191151-105191173 CTTGGAGCCTGGGGAGGTGTGGG - Intergenic
1123894672 15:24816643-24816665 CTTGGCTTCTGGGGAGGTGCAGG - Intergenic
1124659931 15:31539027-31539049 CACCGGTTCTGGGGAGGCGCTGG + Intronic
1125490318 15:40142663-40142685 CTTAGATTCTGGGGCCCTGCTGG + Intergenic
1126049827 15:44675647-44675669 CTTGGCTTCTGAGGAGGAGCTGG - Exonic
1126719406 15:51561307-51561329 CTTTGATTCTGGGTGAGTGCAGG + Intronic
1127841753 15:62837921-62837943 CTTCGACTCTGAGGGGGCGCTGG + Intronic
1130553752 15:84908750-84908772 CTTCGTGTTTGGGGAGGCGCTGG + Exonic
1139466109 16:67155038-67155060 GTTGGAGTCTGGGGAGGGGCAGG - Intronic
1139485931 16:67256631-67256653 CTGGGATTCTGGGCTGGTGCTGG + Exonic
1139908075 16:70380428-70380450 CTTCGAAGCTGGGGAGGTTTAGG - Exonic
1141318514 16:82984269-82984291 CTTCAAGTCTGGGGTGGTTCCGG - Intronic
1141732673 16:85833477-85833499 CTTCGAGTCAGGGGAGATTCTGG + Intergenic
1142301609 16:89261970-89261992 CGTCCTTTCTGGGCAGGTGCCGG + Intergenic
1142417813 16:89952614-89952636 CTGGGAGACTGGGGAGGTGCTGG + Intronic
1147254504 17:39174083-39174105 CTGGGATGCTGGGGAGGGGCAGG + Exonic
1148716165 17:49717662-49717684 CTGCCACTCTGGGGAGGAGCTGG + Exonic
1148970659 17:51478365-51478387 CTTGGCTCCTTGGGAGGTGCAGG + Intergenic
1150005834 17:61468439-61468461 CGTGGTTTCTGGGGAAGTGCAGG + Intronic
1150197331 17:63313983-63314005 GTTGGATTGTGGAGAGGTGCAGG - Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1157102748 18:44744869-44744891 CTTCGATTCTGAGAAGATTCAGG + Intronic
1159935747 18:74366020-74366042 CTTTGAATGTGGGGAGTTGCAGG + Intergenic
1160504919 18:79421601-79421623 TTTCGGTTCTGGACAGGTGCGGG + Intronic
1161660456 19:5542675-5542697 TTTCGAGTCTGGGGAGGTGGAGG - Intergenic
1164810466 19:31150856-31150878 CTTAGATTCTGAGGATGAGCAGG - Intergenic
1164895464 19:31873555-31873577 CTCTGACTCTGGGGAGGTGAAGG - Intergenic
1165604839 19:37093087-37093109 CTTGGCTTCTGGTGAGGTCCAGG + Exonic
1165794539 19:38511339-38511361 CTGGGATGCTGGGGAGGTGAGGG - Intronic
925952470 2:8927948-8927970 CTTGGCTTCTGGGGAGGTCTCGG + Intronic
929322829 2:40566138-40566160 GTTCGATTCTGGGAAGGAGTGGG - Intronic
935502317 2:103856643-103856665 CTTAGGTTCTGGCCAGGTGCTGG + Intergenic
936462126 2:112721763-112721785 CTTGGATTCTGGGGGGCTGGTGG + Intronic
937260302 2:120581356-120581378 CTTCGATTCTGGGAATGTGTGGG + Intergenic
945910138 2:215639564-215639586 CTTCCATTTTGGGGGGGTGGGGG + Intergenic
946356231 2:219187201-219187223 CTTCTGTTTTGGGGAGGTGGGGG - Intergenic
946790389 2:223295160-223295182 ATTCGATTTTTGAGAGGTGCTGG + Intergenic
947989226 2:234473810-234473832 CTTGGCTTCTGGGGAGGCCCAGG + Intergenic
948211665 2:236197853-236197875 ATTCGATTTTGGAGAGGGGCAGG + Intronic
949068011 2:242005194-242005216 CTGAGACTCAGGGGAGGTGCCGG - Intergenic
1169044377 20:2524501-2524523 CTGCGATTCGGGGCAGGGGCAGG - Intronic
1170034891 20:11979927-11979949 CTTAGACTCTGGGGCGGTGGGGG - Intergenic
1170310562 20:14986798-14986820 CTAAGATTCTGAGGAGGTGACGG - Intronic
1173523578 20:43716200-43716222 CTGAGAGTCTGGGGAGGGGCTGG - Exonic
1174157651 20:48527062-48527084 CTTCTTCCCTGGGGAGGTGCAGG - Intergenic
1179469784 21:41602828-41602850 CTTCCTTTCTAGGGAGATGCAGG + Intergenic
1182551645 22:31104022-31104044 CTCCAACCCTGGGGAGGTGCTGG - Intronic
1183128563 22:35809919-35809941 ATTCCATTCTGCGGAGGTGGTGG + Exonic
1183300453 22:37056578-37056600 CTCCGAGTCTGGGGCTGTGCTGG - Intronic
956857641 3:73291663-73291685 CTTCGCATCTGGGGTGGTGCTGG + Intergenic
959123810 3:102265736-102265758 CTTCTTTTCTGGGGATGAGCAGG + Intronic
959924957 3:111910601-111910623 CTTTGATTCTTGAGAGGTTCTGG + Intronic
962234303 3:133694318-133694340 GTACGATTCTTGGGAGGAGCAGG - Intergenic
962279370 3:134038698-134038720 CTTGGGCTCTGTGGAGGTGCAGG - Intronic
967812535 3:193772775-193772797 CCTCTCTTCTGGGGAAGTGCTGG + Intergenic
968950198 4:3687495-3687517 CATGGATGCTGGGCAGGTGCGGG + Intergenic
973972462 4:56226986-56227008 CTTGGCTTCTGGTGAGGTGTCGG - Intronic
976252300 4:83064994-83065016 CTAAGCTTCTGGGGAGGTGGAGG - Intronic
976412797 4:84735725-84735747 CTTAGATTCTGGGATGGTGAAGG + Intronic
976453661 4:85220409-85220431 CTGGGCTTCTGGGGAGCTGCAGG - Intergenic
985645764 5:1084070-1084092 CTTCCTGTCTTGGGAGGTGCAGG - Intronic
985846562 5:2354028-2354050 CTGCGGGTCTGGGGATGTGCAGG - Intergenic
986397817 5:7347612-7347634 CTTGGAATCTGGGGAGGCCCTGG - Intergenic
986739982 5:10697464-10697486 TTTCAATTATGGGGAGGTGCTGG + Intronic
987291963 5:16517344-16517366 CTTAAATTCTGGTGAGGTGGGGG - Intronic
993897829 5:93559312-93559334 CTTCGATTCTGTGAAGGTTGAGG - Intergenic
996679953 5:126220970-126220992 CGTGGGTTCTGGGTAGGTGCGGG + Intergenic
1006799846 6:36752840-36752862 CTTGGGATCTGGGGATGTGCAGG + Intronic
1007927804 6:45663784-45663806 CTTCGCTGCTGGGGAGGGACAGG - Intronic
1008007163 6:46423043-46423065 CTTGGTTCCTGGGGAGGTCCAGG + Intronic
1012456250 6:99409250-99409272 CTTCGATTCTGGGGAGGTGCTGG + Exonic
1014827729 6:126065483-126065505 CTTTAATTCTGGGGAACTGCTGG + Intergenic
1018988876 6:168658419-168658441 CTTCCATTCCTGGGTGGTGCAGG + Intronic
1024529616 7:50380480-50380502 CTTCCGTGCTGGGCAGGTGCTGG - Intronic
1025006524 7:55360028-55360050 CTTGGCTTCTGGGGAGGCCCTGG + Intergenic
1027904840 7:84166158-84166180 CTCAGATTCTGGGGAGGTTGAGG + Intronic
1030870304 7:114747495-114747517 CTGCAACTCTGGTGAGGTGCTGG + Intergenic
1035375071 7:158402290-158402312 TTTCCAATTTGGGGAGGTGCTGG - Intronic
1038744358 8:30244163-30244185 CTTGGATTTTGGTGAGGTTCTGG - Intergenic
1039007088 8:33051279-33051301 CTTCACTTCTGGGCATGTGCAGG - Intergenic
1039896400 8:41719540-41719562 CCTCGAATCTGGGGAGCTCCGGG + Intronic
1040583487 8:48716481-48716503 CTTCGAGGCCGAGGAGGTGCCGG + Intronic
1041886632 8:62816738-62816760 CTTCAATTATGTGGAGATGCAGG + Intronic
1046351822 8:113025319-113025341 CTTTGATTCTGGGTAGAAGCAGG + Intronic
1047289003 8:123512924-123512946 CTTGGCTTTTGGGGAGATGCTGG - Intronic
1047720933 8:127638415-127638437 CTTAGCCTCTGGGGATGTGCAGG + Intergenic
1047818434 8:128490986-128491008 CTTAGCTTCTTGGGAGTTGCTGG + Intergenic
1056819230 9:89825581-89825603 CTTCTCTTCTGGGGAGGGGGTGG + Intergenic
1061629108 9:131860484-131860506 CTGCGTGTCTGGGAAGGTGCTGG + Exonic
1062314171 9:135957616-135957638 CTACTCTTCTGGGGAGGAGCAGG - Intronic
1187389728 X:18878111-18878133 CTTGGATCCTGGGGAGGCTCTGG + Intergenic
1189547397 X:42055934-42055956 CTTGGCTTCTGGGGAGGCTCAGG + Intergenic
1195079809 X:101360179-101360201 CCTGGAGGCTGGGGAGGTGCTGG - Intronic