ID: 1012465640

View in Genome Browser
Species Human (GRCh38)
Location 6:99514279-99514301
Sequence GCATTTTCACTGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012465640_1012465646 14 Left 1012465640 6:99514279-99514301 CCTTCCTCCATCAGTGAAAATGC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1012465646 6:99514316-99514338 AGGGAAGCCCATTAAAGACTTGG 0: 1
1: 0
2: 7
3: 26
4: 198
1012465640_1012465649 22 Left 1012465640 6:99514279-99514301 CCTTCCTCCATCAGTGAAAATGC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1012465649 6:99514324-99514346 CCATTAAAGACTTGGTGTCCCGG No data
1012465640_1012465644 -5 Left 1012465640 6:99514279-99514301 CCTTCCTCCATCAGTGAAAATGC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1012465644 6:99514297-99514319 AATGCAGCAGTTTCCGCGCAGGG No data
1012465640_1012465643 -6 Left 1012465640 6:99514279-99514301 CCTTCCTCCATCAGTGAAAATGC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1012465643 6:99514296-99514318 AAATGCAGCAGTTTCCGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012465640 Original CRISPR GCATTTTCACTGATGGAGGA AGG (reversed) Intronic
900913946 1:5621275-5621297 GAATTTTCATTGTTGGAGGTTGG - Intergenic
901632048 1:10652874-10652896 GCAATGGCACTCATGGAGGAGGG + Intronic
901693421 1:10989139-10989161 GCATGTTCATAGATGGAGGCGGG - Intergenic
901824005 1:11848654-11848676 GCAACTTGACCGATGGAGGAAGG + Intergenic
902060524 1:13638297-13638319 TAATCTTCACTGTTGGAGGAGGG - Intergenic
906078861 1:43070464-43070486 GCATTTTGACATATGGAGGTGGG + Intergenic
906721884 1:48012393-48012415 GAGCTTTCACTCATGGAGGAAGG - Intergenic
908031123 1:60001003-60001025 GCCTTTTCTCTGATGCTGGATGG - Intronic
908364568 1:63406226-63406248 GAATTCTCAATGTTGGAGGAAGG + Intronic
910224208 1:84919764-84919786 GGCTTTTCACTGATGGAGGGTGG + Intergenic
910448545 1:87324300-87324322 GCATTTTGCCTGATGTAGCAAGG - Intergenic
911942871 1:104069572-104069594 GCATGGTCACTGATGGGGGATGG + Intergenic
912221550 1:107683073-107683095 AAATTTTCTCTGATGGAGGGTGG + Intronic
912784602 1:112588358-112588380 GCCTTTTTTCTGATGGTGGAGGG + Intronic
913402086 1:118447938-118447960 TGATCTTCACTGTTGGAGGAAGG + Intergenic
913613271 1:120529667-120529689 ACATCTTCACTGATGGTGGGTGG + Intergenic
914049296 1:144118474-144118496 GCATTTTCTTTGAGGGTGGAGGG + Intergenic
914129888 1:144846970-144846992 GCATTTTCTTTGAGGGTGGAGGG - Intergenic
914371622 1:147030425-147030447 ACATCTTCACTGATGGTGGGTGG + Intergenic
914577916 1:148992580-148992602 ACATCTTCACTGATGGTGGGTGG - Intronic
916415118 1:164585250-164585272 GAATTTTCACTAAGGGAGGAGGG - Intronic
916610325 1:166385442-166385464 GCATTTACCCTGGTGTAGGAGGG + Intergenic
917237377 1:172908962-172908984 CCATTTTGACTGATGTAAGATGG - Intergenic
918080422 1:181203630-181203652 ACATTTTAACTGGTGGAAGAAGG - Intergenic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921413688 1:214866225-214866247 GCATTTTCAATCATGGTGGAAGG + Intergenic
921463830 1:215461658-215461680 ACATATCCCCTGATGGAGGAGGG - Intergenic
922350326 1:224729922-224729944 GCATTTTGCCTGATGGTGGATGG - Intronic
1062772943 10:118747-118769 GCAATTTCACTGTTGGAGTGAGG - Intergenic
1063051056 10:2448039-2448061 GGATTTTAACTGATGCAGAAGGG - Intergenic
1063125669 10:3134625-3134647 GCATTTTCACCAAGGCAGGACGG - Intronic
1063952166 10:11233715-11233737 GTATCTTCACTGTTGGAGGTTGG - Intronic
1064837177 10:19546226-19546248 GCATATTCACTGTTAGGGGAAGG - Intronic
1065696736 10:28387563-28387585 GCATTTTCACTCATTGAAAAAGG - Intergenic
1066293095 10:34031487-34031509 ACATTTTCATAGATAGAGGATGG - Intergenic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1067087598 10:43251070-43251092 GCCTATTCCCTGATGGAGGCCGG + Intronic
1067392592 10:45877874-45877896 GCATTCCCACTGATGGAATATGG + Intergenic
1067860917 10:49846990-49847012 GCATTCCCACTGATGGAATATGG + Intronic
1068130186 10:52886782-52886804 GGATTTTGGCTGATGAAGGAAGG - Intergenic
1070654717 10:78263418-78263440 CCATTTTCTGTGTTGGAGGAAGG + Intergenic
1072802812 10:98405107-98405129 GCCTTTGCACTGGTGGAGAAGGG - Intronic
1076151107 10:128162509-128162531 GCACTCTCCCTGCTGGAGGATGG + Intergenic
1076551547 10:131281499-131281521 GCATTTGTGCTGATGCAGGAAGG + Intronic
1078551688 11:12285624-12285646 GCATTTTCACAAATGGAGTAAGG + Intronic
1078976284 11:16481696-16481718 GCATGTTCAATGATGGTGGTTGG + Intronic
1079274924 11:19026457-19026479 ACATTTTCAATAATGGTGGAAGG + Intergenic
1079989090 11:27228437-27228459 TCCTTTTCACTGAGGGAGGGAGG - Intergenic
1080059954 11:27946599-27946621 GAATTTTCCCTGGTGGAGGTGGG - Intergenic
1081477553 11:43449408-43449430 GCCTCTGCACTGGTGGAGGAGGG - Intronic
1083464708 11:62837647-62837669 GAATTTTGACTGGTGGAGAAGGG - Intronic
1083584278 11:63845365-63845387 GAACTTCCACTGAAGGAGGAAGG - Intronic
1083664873 11:64268911-64268933 GCATTGACCCTGAGGGAGGAGGG - Exonic
1086499170 11:87434635-87434657 GGATTTTCCCTCAGGGAGGATGG - Intergenic
1087087955 11:94238843-94238865 GCATTCTCACTGGTGTAAGATGG + Intergenic
1088553333 11:111036809-111036831 GAACTTTTACTCATGGAGGAAGG - Intergenic
1090263761 11:125341479-125341501 GCATGTTCACTGGGGGAGAAGGG - Intronic
1090525681 11:127532622-127532644 GAAGTTTCAATTATGGAGGATGG - Intergenic
1091760197 12:3082246-3082268 GCATTTCAACAGAAGGAGGAAGG + Intronic
1093395505 12:18676432-18676454 GCATTTTCACTGAAGAAGCAAGG - Intergenic
1095409822 12:41909337-41909359 GAGTTTTCACTCATGGTGGAAGG - Intergenic
1096113755 12:49043270-49043292 GCATTGTCAGTGTTGGAGGCTGG - Intronic
1098723495 12:73931425-73931447 GGATTTTCAGTAATGAAGGATGG - Intergenic
1099591551 12:84597796-84597818 GCATTTTTCCTGATAGAGAAGGG + Intergenic
1100153765 12:91773049-91773071 GAATTTACAATCATGGAGGAAGG + Intergenic
1100444330 12:94647266-94647288 ACATTTTCACTAAGGGGGGAGGG + Intronic
1101034515 12:100692250-100692272 GCATTGCCAGTGTTGGAGGAGGG + Intergenic
1101843850 12:108346247-108346269 GGGTTTTCTCTGATGGGGGAGGG + Intergenic
1104148391 12:126057181-126057203 GCATTTTTCCTGATCGAGTAAGG - Intergenic
1104463850 12:128974960-128974982 TCATCTTCACTGCTGGTGGAGGG - Intronic
1104585552 12:130045436-130045458 GCATTTTGGCTTATGCAGGATGG + Intergenic
1105730145 13:23205681-23205703 TCCATTTCACTGATGGAGAAGGG + Intronic
1105954504 13:25268121-25268143 GTATGTGGACTGATGGAGGAGGG - Intronic
1108466079 13:50716457-50716479 GTACTTTGACTGATCGAGGAAGG + Intronic
1110113048 13:71775036-71775058 GCACTTTGAGAGATGGAGGAAGG + Intronic
1110698835 13:78523433-78523455 GAATATTCACTGATGGACCAAGG - Intergenic
1112515408 13:100048991-100049013 AAACTTTCACTCATGGAGGAAGG + Intergenic
1112946070 13:104928580-104928602 GAATTTACACTGAGGGATGATGG - Intergenic
1112993055 13:105537119-105537141 GCATTTTCACAGGCAGAGGACGG - Intergenic
1114133034 14:19815278-19815300 GCTTTTACACTGTTGGTGGAAGG - Intronic
1114481104 14:23035045-23035067 CCATTTTCACTGAAGGGGGTCGG + Exonic
1116430954 14:44844734-44844756 GCATTTTCAATGATAAAGAAAGG + Intergenic
1118187640 14:63551587-63551609 GCTTTTTGAATGCTGGAGGAGGG + Intergenic
1121388440 14:93552324-93552346 GCATCTTTAGTTATGGAGGAGGG + Intronic
1125174246 15:36802577-36802599 GCATCTTTACTTATGGAGAATGG - Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1128417829 15:67463251-67463273 GCATTTTCACTGTAGGAAGTTGG - Intronic
1131565309 15:93480152-93480174 GCCTTTTAATGGATGGAGGAGGG - Intergenic
1133230453 16:4364234-4364256 GCAGTGTCGCTGAGGGAGGATGG + Intronic
1133411500 16:5572923-5572945 GCATTTTCTCTGAGGGAGACTGG + Intergenic
1133488140 16:6240131-6240153 GAACTTTCACTCATGGCGGAAGG - Intronic
1133921251 16:10155305-10155327 TCATTTTCTGTGATGGGGGATGG - Intronic
1134771462 16:16812841-16812863 GCTTTTTCACACATGGAGGGTGG + Intergenic
1135011342 16:18882272-18882294 GTAATGACACTGATGGAGGAGGG + Exonic
1135318249 16:21469853-21469875 GTAATGACACTGATGGAGGAGGG + Intergenic
1135371142 16:21901648-21901670 GTAATGACACTGATGGAGGAGGG + Intergenic
1135440644 16:22469067-22469089 GTAATGACACTGATGGAGGAGGG - Intergenic
1137636845 16:49994142-49994164 GCAGTTTCACTGATTGAGACTGG - Intergenic
1139889865 16:70243733-70243755 GTAATGACACTGATGGAGGAGGG + Intergenic
1141804039 16:86330957-86330979 GCATTTTCCCTGAAATAGGAAGG + Intergenic
1203137862 16_KI270728v1_random:1740680-1740702 GCATTTTCTTTGAGGGTGGAGGG - Intergenic
1144317335 17:14075027-14075049 GCATTTTCTCAGATGGAAAAGGG + Intronic
1144358022 17:14464195-14464217 GCACTTTCACAGATCAAGGAGGG - Intergenic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1148187232 17:45653505-45653527 GCATTGTAACAGGTGGAGGATGG - Intergenic
1149338286 17:55660333-55660355 GCATTTTCTCTGAAGGAAGTGGG - Intergenic
1149457857 17:56802912-56802934 GCATTTTCACTGATGTGCCAAGG + Intronic
1149943033 17:60891598-60891620 GCATTTTCACTGAAAGAGACTGG - Intronic
1150361146 17:64535335-64535357 GAATTTACACTGATGAAGGGAGG + Intronic
1151564503 17:74890288-74890310 GCAAGTGCACTGCTGGAGGAGGG - Intronic
1152306718 17:79525231-79525253 GCATTTTCTCCGTTGGAGGTGGG - Intergenic
1152925112 17:83083762-83083784 GCATTTTCTCTGCTGCAGAAAGG + Intronic
1153605703 18:6829106-6829128 TACATTTCACTGATGGAGGATGG - Intronic
1154164177 18:12001785-12001807 GCCTTTTCAGAGATGGAGGCTGG - Intronic
1155679870 18:28475781-28475803 CCACTGACACTGATGGAGGATGG - Intergenic
1156402223 18:36749870-36749892 CCATTTTCACTGATGTGAGATGG + Intronic
1156429297 18:37054107-37054129 CCATTTTGACTGATGTAAGATGG - Intronic
1156951242 18:42900995-42901017 GCATTTTTACTGATGGTGCAAGG + Intronic
1157156283 18:45269537-45269559 GCAGTTTGACTGATGATGGAGGG - Intronic
1157914106 18:51647706-51647728 ACTTTTTTATTGATGGAGGATGG - Intergenic
1164785862 19:30930256-30930278 TCATTATCACTGATTGAAGATGG + Intergenic
1164900343 19:31915217-31915239 GCAATTTCAAAAATGGAGGAAGG - Intergenic
1166621259 19:44303410-44303432 GCCTTTTCCCAGAAGGAGGAGGG - Exonic
1167815905 19:51880834-51880856 ACATTTTCAGTAATGGAAGAAGG - Exonic
1167854609 19:52227470-52227492 GAATTCTAACTGATGGAGGGAGG + Exonic
1168264416 19:55214299-55214321 GCTTTTCCACTCATGGCGGAAGG + Intergenic
1202688744 1_KI270712v1_random:71369-71391 GCATTTTCTTTGAGGGTGGAGGG + Intergenic
925092432 2:1166581-1166603 GGTTTTTCACTGATACAGGAGGG + Intronic
929175435 2:38970903-38970925 GCAATCTGATTGATGGAGGAGGG - Intronic
932814989 2:74854397-74854419 GCATCTTCACTGCTGCAGTAGGG - Exonic
933165140 2:79067327-79067349 GAACTTCCACTCATGGAGGAAGG - Intergenic
933687936 2:85158033-85158055 GCATTTCCAGGGAAGGAGGAAGG + Intronic
933689860 2:85171667-85171689 GCAGTTTCACTGATAGAGCCAGG + Intronic
934257159 2:91435414-91435436 CAATTTTCACTGATTTAGGAAGG + Intergenic
934540709 2:95172070-95172092 GCATTTTCGTTGCTGGGGGAAGG - Intronic
934615116 2:95765736-95765758 GCATCTTTCCTGCTGGAGGAGGG + Intergenic
935088965 2:99875984-99876006 GAATAGTCACTGAAGGAGGAGGG - Intronic
935148387 2:100412178-100412200 TCATTTTCATTCATGGAGGAGGG + Intronic
937331680 2:121034481-121034503 GCATGTAGACTGATGGCGGAGGG + Intergenic
937788379 2:125929657-125929679 GCATTTTCACTCTGGGAAGAAGG - Intergenic
937801185 2:126081963-126081985 GCATTTTCAGTCATGGATGTAGG - Intergenic
939449883 2:142360420-142360442 TCATTTGCTGTGATGGAGGATGG - Intergenic
939600119 2:144178444-144178466 GCATTTTCATGGGTGAAGGATGG - Intronic
940569960 2:155418306-155418328 CTATTTTTACTGAGGGAGGAGGG - Intergenic
940907649 2:159183559-159183581 GGATTTTCAGTGAGGGAGGAGGG + Intronic
941420915 2:165282034-165282056 GCATTCTCCCTGTTGGAGGGTGG - Intronic
943657077 2:190521239-190521261 CCATTTTCAGTGAAGTAGGAAGG - Intronic
944119553 2:196226294-196226316 GCTTTTTCAATCATGGTGGAAGG - Intronic
944400778 2:199323730-199323752 GTATTTTTATTGGTGGAGGAAGG + Intronic
944986973 2:205188441-205188463 GCAGTTTCAGTGATGGAGGGTGG + Intronic
945191172 2:207189136-207189158 GCCTTTTCAGTAATGAAGGAAGG - Intergenic
945268952 2:207919509-207919531 CCACTTTCACTGCTGGAGGTTGG - Intronic
945440717 2:209875767-209875789 GTGTTTTGACTGATGGAGAATGG - Intronic
946629760 2:221654326-221654348 GGACCTTCACTGATGGATGAAGG - Intergenic
946773873 2:223117474-223117496 GCCTGTACACTGCTGGAGGAAGG + Intronic
949003923 2:241634626-241634648 GCATTTTTACTCCTGGAGGTGGG - Intronic
1168850775 20:975433-975455 GTGTTTTGACTGAGGGAGGATGG - Intronic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1170435033 20:16317844-16317866 GCAATTCCACTCAAGGAGGAAGG + Intronic
1170805112 20:19622844-19622866 GAACTTCCACTCATGGAGGAAGG + Intronic
1171089632 20:22271657-22271679 TCATTTTCACTGAGGGATGAGGG - Intergenic
1172202747 20:33138420-33138442 GGATTCTCACAGATGGAGTAGGG - Intergenic
1172802410 20:37585396-37585418 GCTTTTTGAATGGTGGAGGAAGG + Intergenic
1175619296 20:60430048-60430070 GCCTGATCACTGATGGAAGAGGG - Intergenic
1177883075 21:26717268-26717290 GCATTTTTACTGTTTGGGGAAGG - Intergenic
949178505 3:1096852-1096874 ACATTTTCACTGAAGACGGAGGG + Intronic
949290155 3:2455612-2455634 GTTTTGTCAGTGATGGAGGAAGG + Intronic
952519037 3:34136684-34136706 CCATTCTCACTGGTGGAAGATGG - Intergenic
953428231 3:42813632-42813654 TCATTCTCAGTGTTGGAGGAGGG - Intronic
956934283 3:74082207-74082229 TCCTTTTCACTGCTGGAGGCTGG + Intergenic
958741096 3:98073349-98073371 GCATTTTCCTTGATGAAGAAAGG - Intergenic
959083685 3:101829049-101829071 GCATAATCCCTGATGGAGCAGGG + Intronic
960963774 3:123090608-123090630 TCATTTTCTCTGATGGAGGATGG + Intronic
962930038 3:140027614-140027636 GCCTTCACACTGATTGAGGATGG - Intronic
969720424 4:8890497-8890519 GCATTTTCACAAATTGAGGTAGG + Intergenic
969972020 4:11057644-11057666 GTGTTTTCACTGCTGGGGGAAGG + Intergenic
971385511 4:26137777-26137799 GTATTTTGACAGATGGAGGGAGG - Intergenic
972319569 4:37960920-37960942 GCATTTTCACAGGTGAAGGGGGG - Exonic
973858200 4:55034407-55034429 GCATTTGAAATGGTGGAGGAAGG + Intergenic
974382598 4:61160635-61160657 CTATTTCCATTGATGGAGGAGGG + Intergenic
975663991 4:76715925-76715947 GCATTTTTGCATATGGAGGAGGG + Intronic
976487164 4:85621456-85621478 CCATTTTGACTGATGGGAGATGG + Intronic
977573742 4:98656519-98656541 ACATTTTCACAAATGGAGAAGGG + Intronic
978206138 4:106083234-106083256 GCTTTTTCCCTGCTGGAGCAAGG + Intronic
978334783 4:107654801-107654823 GCATTTGCTCTGATGTATGAGGG - Exonic
978615131 4:110586861-110586883 GCATATTCAGTGTTGGAGAAAGG - Intergenic
981945204 4:150334612-150334634 CTATTTTCTCTGATGGAGGAAGG + Intronic
982796713 4:159654757-159654779 GCTTTTACACTGTTGGCGGAAGG - Intergenic
985209267 4:187574339-187574361 GCATTTTCTCTGGTGTAAGATGG + Intergenic
986133312 5:4950546-4950568 GCATTTTCTCTGAGGAAGCATGG + Intergenic
986628746 5:9748541-9748563 GCGCTTTCACTCATGGTGGAAGG + Intergenic
987197758 5:15544286-15544308 GCAATCTAACTGATGCAGGACGG - Intronic
987693309 5:21296602-21296624 ACATTTTTACTGATGGCGAAAGG - Intergenic
990130114 5:52571180-52571202 GCATTTTGATAGGTGGAGGATGG + Intergenic
991485371 5:67129952-67129974 TCATCTTCACTGCTGAAGGAAGG - Intronic
991746968 5:69752954-69752976 ACATTTTTACTGATGGCGAAAGG + Intergenic
991750737 5:69802288-69802310 ACATTTTTACTGATGGCGAAAGG - Intergenic
991798570 5:70332896-70332918 ACATTTTTACTGATGGCGAAAGG + Intergenic
991826345 5:70628266-70628288 ACATTTTTACTGATGGCGAAAGG + Intergenic
991830026 5:70677185-70677207 ACATTTTTACTGATGGCGAAAGG - Intergenic
991890901 5:71332219-71332241 ACATTTTTACTGATGGCGAAAGG + Intergenic
991940269 5:71844555-71844577 AAATTTTCACTGATAGAGGGAGG - Intergenic
992045383 5:72883117-72883139 ACGTTTTCACCGATCGAGGACGG + Exonic
992676056 5:79107528-79107550 GCATTTTCACCTGTGGTGGAAGG + Intronic
992755477 5:79901659-79901681 CTATTTTCATTGATGGAGTAAGG + Intergenic
992782343 5:80139764-80139786 GCATTGTCCCTGAAGAAGGAGGG + Exonic
996535048 5:124569131-124569153 GTATTTTAAATGATGGAGGTTGG + Intergenic
997562050 5:134854952-134854974 GCATCTTCATTGAGGCAGGAAGG - Exonic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
1000114438 5:158139969-158139991 GCATTTTGGGAGATGGAGGAGGG - Intergenic
1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG + Intergenic
1000880033 5:166686833-166686855 GGTTTTTCACTGTTGGAGAATGG - Intergenic
1002015989 5:176323232-176323254 GCATTTGGACAGATTGAGGAAGG + Intronic
1003945443 6:11071317-11071339 GCATTTCCATAGATGGAGAAAGG - Intergenic
1004806689 6:19210779-19210801 GCATTCACACTGCTGGGGGAGGG + Intergenic
1005545598 6:26866227-26866249 GCATTTCCATTTTTGGAGGATGG + Intergenic
1007449923 6:41935097-41935119 GCATTTTCCCTGCTGGAGGATGG + Exonic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1009016302 6:57906993-57907015 GCATTTCCATTTTTGGAGGATGG + Intergenic
1010767468 6:79792766-79792788 GTATTCTCACTGTTGGAGAATGG - Intergenic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1012474427 6:99604590-99604612 GCTTTTTCACTCATTAAGGAGGG + Intergenic
1012741180 6:103018377-103018399 GCTTTTTCCCTGCTGGAGCAAGG - Intergenic
1012785734 6:103623392-103623414 GCATTTTAACTGATCAAGAAAGG + Intergenic
1014335500 6:120129020-120129042 ACATTTTCTTTGATGGAGGCTGG - Intergenic
1014712705 6:124826323-124826345 GCATTTTGACTGATGGGAGCTGG - Intergenic
1015180379 6:130355566-130355588 ACATCTTCTCTAATGGAGGAAGG + Intronic
1015811159 6:137163517-137163539 CCATTTGCACTGTTGGAGGAAGG - Intronic
1015894882 6:138007621-138007643 GCTATTTCACTGAAGGAGGTGGG - Intergenic
1018024385 6:159792527-159792549 ACATTTTTACTCATAGAGGAGGG + Intronic
1020386591 7:7611521-7611543 GCATTTTCATGGATGTGGGAAGG + Intergenic
1021352042 7:19605804-19605826 GCACTTTCACTGCTGGTGGATGG - Intergenic
1021930521 7:25576941-25576963 GAATCCTCACTGTTGGAGGAGGG - Intergenic
1021938079 7:25651381-25651403 ACATCGTCACTGATGGAAGATGG + Intergenic
1022302621 7:29115362-29115384 GCTTTTTTTCTGATGGAGGAGGG - Intronic
1023605258 7:41925410-41925432 TCATTGTCACTTATGAAGGATGG - Intergenic
1024907474 7:54403939-54403961 GCATTCTGACTGATGTAAGATGG + Intergenic
1024966478 7:55026600-55026622 GCATCTTCCCTGCTGGAGGGGGG - Intronic
1028051672 7:86195506-86195528 GCATTTCTACTGATGAAGTAAGG - Intergenic
1030250812 7:107442083-107442105 TCATCTTCAATGTTGGAGGAGGG + Intronic
1030305045 7:108009174-108009196 GCATATTGACTGATGCAGGCAGG + Intergenic
1031025671 7:116677059-116677081 GCAATATCTCTGATAGAGGATGG - Intronic
1033026096 7:137774244-137774266 ACATTTTCACTGTTGGAAAAGGG + Intronic
1035691824 8:1564323-1564345 CCAGTTTCACAGATGGTGGATGG + Intronic
1038903753 8:31873968-31873990 ACATTTTCATTGATGGATCAAGG - Intronic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039676923 8:39678376-39678398 GTAATTTCACATATGGAGGAGGG - Intronic
1039883809 8:41644314-41644336 GCATCTTCACAGATGGAGGGTGG + Intergenic
1040075691 8:43227033-43227055 CCATTTTCACTCAGGGAGGCTGG - Intergenic
1040751261 8:50711884-50711906 GCATTTTCACTGTTAGAGAAGGG + Intronic
1040798975 8:51320537-51320559 CCATGTTCACTGATGGACGAGGG - Intronic
1042217806 8:66443889-66443911 GCTTTTACACTGATGGATGATGG - Intronic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1044244084 8:89920598-89920620 GAATTATAATTGATGGAGGAGGG + Intronic
1044622044 8:94200254-94200276 GCAATTTCAGTGATGAAGGATGG - Intronic
1044711910 8:95066688-95066710 GCCTTTTCACTGTTAGAAGAGGG - Intronic
1046024735 8:108708555-108708577 GCATTCTGACTGATGAAAGATGG + Intronic
1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG + Intergenic
1050284510 9:4087487-4087509 GTATTTTCACTGGAGGAGGGAGG - Intronic
1050784037 9:9376390-9376412 ATAATTTGACTGATGGAGGAAGG - Intronic
1050996405 9:12224442-12224464 GAATTTCCACTCTTGGAGGAAGG + Intergenic
1051020032 9:12532725-12532747 GCATGTTCATAGATGGTGGAGGG - Intergenic
1052622107 9:30925754-30925776 GCATTTTTACTCATGGCAGAAGG + Intergenic
1059505944 9:114799968-114799990 GCATCTTCACTGAGGGATAAGGG + Intronic
1059848826 9:118313156-118313178 TAATTCTCACTGTTGGAGGAAGG - Intergenic
1061892008 9:133627178-133627200 TAATTCTCACTGTTGGAGGAGGG - Intergenic
1186732895 X:12429276-12429298 GCATCTCCACTGATTGTGGAAGG + Intronic
1189981424 X:46514557-46514579 GCAATTTCCTTGATGCAGGAAGG - Intronic
1192669409 X:73123993-73124015 ACATTTTCAGTGCTGGAAGAAGG + Intergenic
1194582600 X:95695101-95695123 GCAATTTTATTGATGGGGGAAGG - Intergenic
1195726077 X:107918080-107918102 CCATATTCACTGATAGAGGTAGG - Intronic
1196696220 X:118615146-118615168 GCATTTTCACTGCTAGAAGGAGG - Intronic
1197299531 X:124761079-124761101 GCTTTTTCACTGTTGGTGGGAGG + Intronic
1197886359 X:131222207-131222229 TCATTTTCATTTATGAAGGATGG - Intergenic
1198141248 X:133805912-133805934 CCATTTTCACTGATGAAAAAAGG + Intronic
1202356611 Y:24058208-24058230 GCTTTTTCACTGAGGGAGTTAGG + Intergenic
1202514167 Y:25611901-25611923 GCTTTTTCACTGAGGGAGTTAGG - Intergenic