ID: 1012466479

View in Genome Browser
Species Human (GRCh38)
Location 6:99521717-99521739
Sequence CTGCATCCACAGATAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012466479 Original CRISPR CTGCATCCACAGATAAAAGT TGG (reversed) Intronic
904377375 1:30090338-30090360 CTGCATCCCCAGAGAAAGGGAGG + Intergenic
907411381 1:54286149-54286171 CTGAGCCCACAGATAACAGTGGG + Intronic
908075158 1:60509212-60509234 ATGCATACACACATAAAATTAGG - Intergenic
908237835 1:62164443-62164465 CTGCCTCCAGGGATAAAACTGGG + Intergenic
909170126 1:72283620-72283642 CAACACCCACAGATAAAAGAGGG - Intergenic
909233477 1:73121042-73121064 CTGAATCAACAGAAAAAAATGGG + Intergenic
911405848 1:97438285-97438307 CTTTATCCATAGATAAAAATGGG + Intronic
915476621 1:156156340-156156362 CTGACTCCTGAGATAAAAGTGGG - Intronic
916782718 1:168053293-168053315 ATGCATACAGAAATAAAAGTTGG + Intronic
917893592 1:179464519-179464541 GGGCAGCCACAGAGAAAAGTCGG - Intronic
920097140 1:203493689-203493711 CAGAATCCAAAGATAAAAATAGG - Intergenic
923307952 1:232705540-232705562 CTGCATACACAAATATAAATTGG + Intergenic
923337391 1:232982315-232982337 CTGCACCCACAGAGAAAAGGTGG - Exonic
1062778104 10:172670-172692 ATGAATCCATACATAAAAGTGGG - Intronic
1062933933 10:1371809-1371831 CTGCATCCACACAAACATGTTGG - Intronic
1066046035 10:31596398-31596420 CTGCATCCTGGGATAACAGTGGG + Intergenic
1067273379 10:44811973-44811995 CTGCCACCAGAGATAAAAGAAGG + Intergenic
1075115243 10:119620674-119620696 CTGCACCAACAGAGAACAGTGGG + Intergenic
1075267579 10:121016460-121016482 TTGAATCCACAGATAAAACTGGG - Intergenic
1075977934 10:126712982-126713004 CTGCATGCTCAGTTAACAGTAGG - Intergenic
1084280099 11:68083616-68083638 CTTCATCCAAAGTTAAAAATTGG + Intronic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1087364722 11:97203745-97203767 CAGTATCCAAAGAAAAAAGTAGG + Intergenic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1089902939 11:122007237-122007259 TTGAGTCCACAGATAAATGTTGG - Intergenic
1091961852 12:4702217-4702239 CAGCATCCACAGATAACAAGGGG - Intronic
1094404446 12:30100341-30100363 TTGCATTCACATATTAAAGTGGG - Intergenic
1098320764 12:69240387-69240409 TTGGAGCCACAGATAAAAGTCGG + Intronic
1098808521 12:75053170-75053192 CTAAATCTACAGATAAAATTGGG - Intronic
1098992428 12:77078457-77078479 GTGCATGCACAGAGAAAAGGAGG + Intergenic
1099785616 12:87258878-87258900 CTGCATCCAAAGAATAAACTTGG - Intergenic
1099887445 12:88549063-88549085 CTGCATACAGAGAGAAAAGCTGG + Intronic
1100990134 12:100243213-100243235 GTGAAACCACAGATAAAAGGGGG + Intronic
1101883715 12:108643543-108643565 TGGCATACACAGAAAAAAGTTGG + Intergenic
1104423430 12:128655694-128655716 CAGCAGCCACAGAGAACAGTGGG + Intronic
1108582119 13:51836735-51836757 CTGCCCCCTCAGATAAAGGTTGG - Intergenic
1109663743 13:65501545-65501567 CTCCATAAACTGATAAAAGTGGG + Intergenic
1110352304 13:74522841-74522863 GTCCATGGACAGATAAAAGTAGG - Intergenic
1110612298 13:77502478-77502500 CTGCAGCTACAGATTAAATTTGG + Intergenic
1111059667 13:82999634-82999656 CTGCTTCCTAAGTTAAAAGTGGG + Intergenic
1111066777 13:83104544-83104566 CTCCAGCCACAGAAAAAAGCAGG + Intergenic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1113250032 13:108442521-108442543 CTGCATCCTCACATAACAGAAGG + Intergenic
1113920170 13:113903308-113903330 CTACATCCACTGATAAAGTTCGG + Intergenic
1114093078 14:19305344-19305366 CTGCATCCCCAGAGTAAGGTGGG - Intergenic
1114244240 14:20897898-20897920 CTTCCTCCACATATAAAAATAGG + Intergenic
1114247276 14:20926401-20926423 CTTCCTCCACATATAAAAATAGG + Intergenic
1115147966 14:30248409-30248431 CTGGATGCACAGACAATAGTGGG + Intergenic
1117543663 14:56772609-56772631 ATGAATCCAGAGATGAAAGTAGG + Intergenic
1123933067 15:25181177-25181199 CTCCATCCCCAGAGAAAGGTGGG + Intergenic
1126195126 15:45922847-45922869 CTGCAGCCACAGAAAAAGATTGG - Intergenic
1128282071 15:66404133-66404155 TTGCGTCCACTGATAAAACTAGG + Intronic
1128882583 15:71257161-71257183 CTGATTCCAAAGATAATAGTAGG + Intronic
1133093847 16:3427300-3427322 CTCCATTCAGAGATAAAACTAGG - Intronic
1133487807 16:6237299-6237321 CTTCTTCCACAGGGAAAAGTAGG - Intronic
1134468155 16:14497395-14497417 CTGCATCTACAGATTCAAGTTGG + Intronic
1135076609 16:19399531-19399553 CCCCCTCCACAGCTAAAAGTGGG - Intergenic
1137449925 16:48562650-48562672 CTGCATCCAAATCTAAAAGGTGG + Intronic
1137775893 16:51054057-51054079 CTGTCTGCACAGATAAAACTTGG + Intergenic
1139464441 16:67146770-67146792 CTGCATCCACAGGGAAAACAAGG - Intronic
1144043145 17:11430699-11430721 GTGCATCCAGAAATAGAAGTCGG - Intronic
1144821742 17:18079658-18079680 CTTCATCCAGAGATAGAACTTGG - Intergenic
1151374519 17:73676905-73676927 CTGAATACAGAGGTAAAAGTAGG - Intergenic
1154072901 18:11169865-11169887 TTGAATCCATAGATAAATGTGGG - Intergenic
1159165139 18:64689478-64689500 CAGTATGCACAGATAAAAGTTGG - Intergenic
1160358454 18:78248606-78248628 CTGCATCCACACATCTAAGCCGG - Intergenic
1160462938 18:79053034-79053056 CTGCATCCCCCGATGAAAGCAGG - Intergenic
1161810163 19:6466896-6466918 CTGGACACACAGAGAAAAGTTGG - Intronic
1162784653 19:13026993-13027015 CTGGATCCAGAAATAAAATTCGG + Intronic
1164828257 19:31300167-31300189 CTTCATCCTCTGATAAATGTGGG + Intronic
1165880505 19:39039280-39039302 CTGCATGCAAAATTAAAAGTGGG + Intergenic
925528125 2:4827133-4827155 CTGCATCCACTGATAGACCTTGG - Intergenic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
926134568 2:10327193-10327215 TTGCAGCCACAGCTAAGAGTGGG + Intronic
926357057 2:12050336-12050358 CAGAATCCAGAGATAAAGGTGGG + Intergenic
927902983 2:26835278-26835300 TTGAATCCATAGATAAAATTGGG - Intergenic
929010957 2:37443637-37443659 CTTCATTCACAGAGATAAGTGGG + Intergenic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
931730138 2:65145944-65145966 CTGCATCAAAAAAAAAAAGTTGG + Intergenic
934197301 2:89849361-89849383 ATGCATCAACAGATAAGAGAGGG + Intergenic
936081284 2:109434270-109434292 CTGCCTCCTCATATAACAGTAGG - Intronic
936684167 2:114808480-114808502 CTGCCCCCAAACATAAAAGTGGG + Intronic
942128331 2:172849914-172849936 ATGGATCCACAGATAGGAGTTGG + Intronic
943085942 2:183311190-183311212 CTGTATACTCAGATACAAGTAGG + Intergenic
945271407 2:207944009-207944031 CTGGAGCTGCAGATAAAAGTAGG + Intronic
946093687 2:217253118-217253140 CTCCATGCAAAGATAAAAGGAGG + Intergenic
946816638 2:223585072-223585094 CTGCATCCACAGAAAAGGTTAGG + Intergenic
947135198 2:226970445-226970467 CTTCATGTACAGATAAAACTTGG - Intronic
947177793 2:227384839-227384861 CAGCAACAACAGATAAAAGGTGG + Intergenic
948039382 2:234887432-234887454 CAGCAGCCGCAGATAAAAGTGGG - Intergenic
1170195891 20:13689136-13689158 CTGCATGCACAGTTCACAGTAGG - Intergenic
1170508063 20:17049041-17049063 AGGCATCCACAGATAGAAATTGG + Intergenic
1171013306 20:21520259-21520281 CTGCATCCACAGTTAATCGCAGG - Intergenic
1173140568 20:40478354-40478376 CTGCATCCACACAGAAGAGCAGG + Intergenic
1179525489 21:41973498-41973520 CTGCATCCACAAAGAACAGGAGG + Intergenic
1180631280 22:17231862-17231884 CTGAATCCAAAGACAAAAGATGG + Intergenic
1182541552 22:31045678-31045700 CTGCAGCCCCAGATAAAATCGGG + Intergenic
949386928 3:3513390-3513412 CTCAATCCAGTGATAAAAGTGGG + Intergenic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950813231 3:15670834-15670856 CTGAATTCACAGAAAAAACTGGG + Intronic
955625593 3:60915287-60915309 CTGATACCACATATAAAAGTGGG + Intronic
958866378 3:99506320-99506342 CTGCATAATCAAATAAAAGTAGG + Intergenic
959148848 3:102583860-102583882 CTTCATCCACATAGAAATGTGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
959979540 3:112500021-112500043 ATGTATCCACAGATTAAAGACGG - Intergenic
960182278 3:114594668-114594690 CTGAATCCACAGCAAAAAGAGGG + Intronic
961826093 3:129599850-129599872 CTGGATCCGCAGATAGAAGCAGG - Intronic
965161452 3:165138774-165138796 GGGCAGCCACAGATAAAGGTCGG - Intergenic
965527703 3:169739164-169739186 CTGTTTCTACAGAGAAAAGTTGG + Intergenic
967712711 3:192727552-192727574 GTGCATCCAGAGAGCAAAGTGGG - Intronic
967811415 3:193764206-193764228 CAACCTCCATAGATAAAAGTAGG + Intergenic
973908302 4:55552630-55552652 CTTCACCCAAGGATAAAAGTTGG + Intergenic
977066013 4:92316345-92316367 CTTCATCCACAGATGTAAGAGGG + Intronic
978164108 4:105586041-105586063 CTTCATCCAGAAATAAAAGACGG + Intronic
980159155 4:129138585-129138607 CTGCAGCCACAGGTACATGTTGG + Intergenic
980216874 4:129863407-129863429 CAGCAACCATAGATAACAGTAGG + Intergenic
980617486 4:135249891-135249913 CTGCAAGCACAGAGAAAATTAGG - Intergenic
980717211 4:136641797-136641819 CTATATCCACAGATAATACTTGG + Intergenic
984273306 4:177574775-177574797 CTGGGTCCCCAGATAAACGTGGG - Intergenic
984967069 4:185148932-185148954 CTGCCTCCCCAGCTAAAAATTGG + Exonic
985270169 4:188186728-188186750 CTGCATCCATATATACAAGGAGG - Intergenic
985679498 5:1248585-1248607 ATGCAGCCATGGATAAAAGTGGG + Intergenic
988614386 5:32760010-32760032 GGGCAGCCACAGAGAAAAGTCGG - Intronic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
996448416 5:123586450-123586472 CTACATCCACTAATGAAAGTGGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999547698 5:152648748-152648770 CTGCAGCTAGAGAGAAAAGTAGG + Intergenic
999902976 5:156106765-156106787 CTGTATACACAGATATTAGTGGG - Intronic
1004092787 6:12521832-12521854 CTGGAACCTAAGATAAAAGTTGG - Intergenic
1006237324 6:32645431-32645453 TTGCATGCACAGTTAAAAATAGG + Intronic
1006759944 6:36451409-36451431 ATGTATCCACAGAAAAAAGATGG - Intronic
1008836702 6:55841055-55841077 TTGCATGCACAGTTAAAAATAGG - Intronic
1009411383 6:63369106-63369128 CTTCATACACAGATAAATGTTGG + Intergenic
1012466479 6:99521717-99521739 CTGCATCCACAGATAAAAGTTGG - Intronic
1012856218 6:104505085-104505107 CTTAATCCACATATAAAATTTGG + Intergenic
1015188735 6:130449351-130449373 TTGCATGCACAGGTAAATGTTGG - Intergenic
1016599155 6:145837180-145837202 CGGCATCAACATATAATAGTGGG + Intergenic
1018540323 6:164872876-164872898 CTGGGTCCACAGAGAAAAATGGG - Intergenic
1018986621 6:168642814-168642836 CTGCATGGAAAGTTAAAAGTTGG + Intronic
1021021931 7:15610928-15610950 ATGAAGCCACAGATAAAAGTAGG - Intergenic
1021520129 7:21530996-21531018 CTGCATCCTCACTTACAAGTGGG - Intergenic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1024478810 7:49842900-49842922 CTGAATCTAAAAATAAAAGTTGG - Intronic
1026655931 7:72256525-72256547 CTGGATTCACAGATAAGACTTGG + Intronic
1030906524 7:115190270-115190292 CTATTTCCACAGATAAAATTTGG - Intergenic
1033463883 7:141573018-141573040 CTTCATCCACAGCTGAAGGTAGG + Intronic
1035014439 7:155752782-155752804 CTGCATCCAAAGTAATAAGTGGG - Intronic
1035918020 8:3646360-3646382 ATGCATGCATAGAAAAAAGTTGG - Intronic
1036545266 8:9762600-9762622 CTGTAACAACAGATAAAATTGGG + Intronic
1038418971 8:27420003-27420025 CTGCACCCACAGATGACGGTGGG + Exonic
1040043713 8:42940653-42940675 GGGCATCCAGAGAGAAAAGTCGG - Intronic
1040398285 8:47020331-47020353 GTGCAGCCACAGAGAAAGGTTGG + Intergenic
1042400657 8:68342500-68342522 CTGAAACCACAGATAAGAGGGGG - Intronic
1044622118 8:94200839-94200861 CTGCATGCACCGATAAGACTTGG + Intronic
1045479970 8:102584023-102584045 CAACCTCCACAGACAAAAGTAGG + Intergenic
1045974521 8:108116270-108116292 CTGCAACCACAGAAAGAACTAGG + Intergenic
1049497663 8:142943985-142944007 CTGCCTCAACAGATAGCAGTGGG - Intergenic
1050651105 9:7777864-7777886 CTGCTTCCCCAGAAAGAAGTGGG - Intergenic
1050918185 9:11163699-11163721 ATCCATACACAAATAAAAGTAGG - Intergenic
1051957211 9:22710851-22710873 CTGCATGTACAGAAAAAAATAGG - Intergenic
1058370658 9:104263304-104263326 CTGGATTCACAGACAATAGTTGG + Intergenic
1058938476 9:109791414-109791436 CTGGGTCCACAGAGAAAAGCAGG + Intronic
1060980304 9:127788095-127788117 CTACATCCACAGAAACAAGGTGG + Exonic
1186370813 X:8945364-8945386 TTGCCTCCACACTTAAAAGTAGG - Intergenic
1187955326 X:24511989-24512011 TTGTATCAACATATAAAAGTGGG + Intronic
1187979371 X:24738859-24738881 CTGCCACTACAGATCAAAGTTGG + Intronic
1188976614 X:36683267-36683289 CTGCATACACAGGGAAAGGTGGG + Intergenic
1189108194 X:38258088-38258110 CTTCATCTAAAGATAAAATTTGG - Intronic
1190149530 X:47932573-47932595 TTGCATCTATAGATAAAATTAGG + Intronic
1190431705 X:50384335-50384357 CTGCCTCCACAGAGAAAATAGGG - Intronic
1194532363 X:95067371-95067393 TTGAATCTACAGATAAAATTTGG - Intergenic
1195864308 X:109412861-109412883 CTGCATTCACCCATAGAAGTGGG - Intronic
1199713221 X:150487031-150487053 CTGACTCCACAGATACAGGTGGG + Intronic
1200982713 Y:9276887-9276909 CCCCCTCCACAGATAAAAGTGGG - Intergenic
1201867276 Y:18668935-18668957 CCCCCTCCACAGCTAAAAGTGGG + Intergenic
1201983238 Y:19930601-19930623 TTTCATCCACAGATAAAATTTGG - Intergenic
1202127680 Y:21582808-21582830 CCCCCTCCACAGATAAAAGTGGG + Intergenic
1202151592 Y:21848674-21848696 CCCCCTCCAGAGATAAAAGTGGG - Intergenic