ID: 1012467176

View in Genome Browser
Species Human (GRCh38)
Location 6:99529161-99529183
Sequence CCCTTGGATACCAAAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012467176_1012467181 12 Left 1012467176 6:99529161-99529183 CCACAGACTTTGGTATCCAAGGG No data
Right 1012467181 6:99529196-99529218 AATCCCCTTCAGATACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012467176 Original CRISPR CCCTTGGATACCAAAGTCTG TGG (reversed) Intergenic
No off target data available for this crispr