ID: 1012469355

View in Genome Browser
Species Human (GRCh38)
Location 6:99553594-99553616
Sequence GAAGATTTACTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012469355 Original CRISPR GAAGATTTACTGAAGGAGGA AGG (reversed) Intronic
900710986 1:4113777-4113799 GGATATTTACTGAAGGAAGGAGG + Intergenic
902280567 1:15371341-15371363 GAAGGATTAGTGGAGGAGGACGG + Intronic
902605492 1:17566839-17566861 AAAGATTTGCTGAATGAGCAAGG + Intronic
902753794 1:18536181-18536203 GAATGTTTATTGAAGGAGGAAGG + Intergenic
903022541 1:20404244-20404266 GAAGAATTACTCAAGTAAGAAGG - Intergenic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
903517756 1:23923753-23923775 GAAGACTTCCTGGAGGAAGAAGG - Intergenic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905260240 1:36712154-36712176 TAAGAATCACAGAAGGAGGAAGG - Intergenic
905277841 1:36830458-36830480 GAAGTTATACTGAATGAGGGTGG + Intronic
905605224 1:39292110-39292132 AAAGCTGTATTGAAGGAGGAGGG + Intronic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906751571 1:48267458-48267480 AAAGTTTTACTGAAGGATGGAGG + Intergenic
906794968 1:48689480-48689502 GAAGAAGGACAGAAGGAGGAAGG - Intronic
906980719 1:50625574-50625596 GATGATTTAATTAAAGAGGAGGG + Intronic
907353799 1:53855411-53855433 GAAAAGTTAATGAAGAAGGAAGG + Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908020620 1:59894367-59894389 GAAGAACCACTGAAGGAGGAAGG - Intronic
908150168 1:61292512-61292534 GAATATGTACTCAAGGAGTATGG - Intronic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
908968227 1:69792890-69792912 GAAGATTTAATGAATGAACAAGG - Intronic
909025659 1:70478974-70478996 GAAGCGCTGCTGAAGGAGGATGG + Intergenic
909028350 1:70509216-70509238 GAAGAGTTTGTGAAGGAGTAGGG + Intergenic
909561873 1:77016301-77016323 GAAGAGTTTCAGGAGGAGGAGGG - Intronic
909689092 1:78386088-78386110 GCAGAATTACTCAAGAAGGAAGG + Intronic
910046822 1:82927617-82927639 AAAGAATTAATGAAGGAGGATGG - Intergenic
910128026 1:83866976-83866998 TTAGATTTACTGAATGAGCAGGG + Exonic
910905163 1:92168285-92168307 GAAAATTTACTGTAGGACCAGGG - Intronic
913685849 1:121231289-121231311 TACGTTTTAGTGAAGGAGGAGGG - Intronic
914037699 1:144018892-144018914 TACGTTTTAGTGAAGGAGGAGGG - Intergenic
914151755 1:145049040-145049062 TACGTTTTAGTGAAGGAGGAGGG + Intronic
915514659 1:156405851-156405873 GAAGAGTTTCAGAAAGAGGAGGG + Intronic
915970680 1:160353014-160353036 GAAGATTTAATTAAAAAGGAAGG - Intronic
916103536 1:161413091-161413113 GGAGGATTACTGAAAGAGGAAGG + Intergenic
916815014 1:168343252-168343274 GAAGGTTTCCTGAAGAAGGAGGG + Intergenic
916815158 1:168344507-168344529 GAAGGTTTCCTGAAGAAGGAGGG - Intergenic
917268500 1:173247357-173247379 GAGTATGTTCTGAAGGAGGAGGG + Intergenic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
917893933 1:179467754-179467776 CAAAATTTACTGATGAAGGAAGG + Intronic
918458961 1:184755765-184755787 GAAGGTTTAATGAAGGAGATTGG + Intergenic
919025937 1:192170457-192170479 GAAGTTTTACTCACGGAGGAAGG - Intronic
919471564 1:197985560-197985582 GAAGATGTCATGAAGGAGGTGGG + Intergenic
920219444 1:204385875-204385897 GGAAATGTACTGAAGGAAGAAGG - Intergenic
920473170 1:206249846-206249868 TACGTTTTAGTGAAGGAGGAGGG - Intronic
920686889 1:208116170-208116192 GAAGACTTCCTGGAGGAGGGAGG - Intronic
921383551 1:214549014-214549036 GAAGTTTTCCTGAAGGTGTAGGG - Intronic
921555929 1:216599060-216599082 GAAGATTATCTGAAGGAGATTGG + Intronic
922016596 1:221654711-221654733 GAACATGTTTTGAAGGAGGAAGG - Intergenic
922658585 1:227408718-227408740 GAGGACTTACTGATAGAGGAAGG - Intergenic
922821188 1:228486999-228487021 CAGGAGTTACTGAAGTAGGAAGG + Intergenic
923684885 1:236147108-236147130 AAAGATTTAATAAAGGAGTATGG - Intronic
924195572 1:241603703-241603725 GAAGAATCAGTGAATGAGGAAGG + Intronic
924905313 1:248445924-248445946 ATAGATTTACTGAAGGAAAATGG + Intergenic
924922576 1:248646132-248646154 ATAGATTTACTGAAGGAAAATGG - Intergenic
1062833086 10:619119-619141 GCAGTTTTACTGAAGGAAGGGGG - Intronic
1063025946 10:2178852-2178874 GAGGATTGAAGGAAGGAGGAAGG - Intergenic
1064871169 10:19938436-19938458 GGAGGTTTACTGATGGTGGAAGG + Intronic
1066106961 10:32164942-32164964 CAAGATGGAATGAAGGAGGATGG - Intergenic
1067574158 10:47397378-47397400 GGAGAATTAGTGAAAGAGGAAGG - Intergenic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1070481126 10:76883809-76883831 GATGTTCTACTGAAAGAGGAAGG + Intronic
1071206547 10:83286252-83286274 GAATATTTGCTTAAGGAGAATGG + Intergenic
1071883445 10:89924282-89924304 GAAGATTTACTGAATGGGACAGG + Intergenic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1073574820 10:104613535-104613557 GAAGAATTCCTGGAGAAGGAGGG - Intergenic
1073591520 10:104762160-104762182 GAGGACTTACTGGAGGAGGTGGG - Intronic
1074993069 10:118728741-118728763 GAAGGTTTACTGAAGTGGGCAGG + Intronic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075612208 10:123863331-123863353 GAGCATTTAGTGAAGGCGGAGGG + Intronic
1076087105 10:127642912-127642934 GAAGTTGTACTGGAGTAGGATGG - Intergenic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1078261195 11:9710614-9710636 GAAGATGTACTGGAGGAGGCAGG - Intronic
1078806551 11:14711506-14711528 GAAGTTTTACTCATGGCGGAAGG + Intronic
1078844768 11:15111079-15111101 GAAGTTATACTGTAGGAAGATGG - Intergenic
1079472013 11:20787288-20787310 GAAGATCTACTTAAGGAGACTGG + Intronic
1079927651 11:26514893-26514915 GAAGATTCACTAAAAGAGAATGG + Intronic
1080936983 11:36874443-36874465 GAAGATTTACTGATGCTAGAGGG + Intergenic
1081675157 11:44964298-44964320 GAAGACTTCCTGCAGGAGGTGGG - Intergenic
1083467822 11:62860626-62860648 GAAGGATTAGTGAAAGAGGAAGG - Intronic
1083584278 11:63845365-63845387 GAACTTCCACTGAAGGAGGAAGG - Intronic
1084452119 11:69245381-69245403 GAATATCTACTGAATGAGTAGGG - Intergenic
1084516713 11:69641667-69641689 GGGTATTTTCTGAAGGAGGAAGG + Intronic
1084600943 11:70145106-70145128 GGAGAATTACTTGAGGAGGATGG + Intronic
1085599483 11:77842191-77842213 GAAGATTTACTTCAGCATGATGG - Intronic
1085745747 11:79112818-79112840 GAAGACTTCCTGGAGGAGGTGGG - Intronic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1086889596 11:92241615-92241637 TAATAGTTACTGAAGGTGGAGGG + Intergenic
1087939470 11:104077879-104077901 GATGATTTTTTGAAGGAGAAGGG - Intronic
1088553333 11:111036809-111036831 GAACTTTTACTCATGGAGGAAGG - Intergenic
1088967621 11:114739457-114739479 TCAGTTTTACTGAAGAAGGAGGG - Intergenic
1090181851 11:124706549-124706571 TAAGATTTAATGAAGCTGGATGG + Intergenic
1090701580 11:129300776-129300798 GAAGATTGACTCAAGGTGGTAGG + Intergenic
1090830183 11:130415905-130415927 GAAGGTTGTCTGAAGGAGGAGGG - Intronic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1091554952 12:1565861-1565883 GAATACTTAATGAAGGAGTAAGG - Intronic
1092044252 12:5417525-5417547 CAAGATTCACTGAAGGAGAAGGG - Intergenic
1092234509 12:6797927-6797949 GGAGGATTAGTGAAGGAGGAAGG - Intronic
1092397041 12:8135898-8135920 TTAGTTTTACTGAAGCAGGAAGG - Intronic
1093205523 12:16244209-16244231 AAAGGTTTAATGAGGGAGGAAGG + Intronic
1093539356 12:20262747-20262769 TAAGATTTGCTGAAGGATCATGG + Intergenic
1093693020 12:22128562-22128584 GAAGAATTATTGGAGGAGGTTGG + Intronic
1093901677 12:24642661-24642683 GGTGAATTACTGGAGGAGGATGG - Intergenic
1094470025 12:30795079-30795101 GAAGATTGACTAAAAGAGGGTGG - Intergenic
1094547030 12:31414298-31414320 ACAGATTTATTGAATGAGGAAGG - Intronic
1095183514 12:39174436-39174458 GAAGAATTCCTGGAGGAGGTTGG + Intergenic
1096640467 12:52990323-52990345 GAAGATGTCTTGAAGTAGGAGGG + Intergenic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1098540993 12:71657636-71657658 GATTATTTTCTGAAGGAAGAGGG + Intronic
1098925083 12:76340641-76340663 GAAGATACAGTGAAGGAGGGAGG + Intergenic
1099648746 12:85396365-85396387 GAAGATTTCATGAAGGAGGTAGG - Intergenic
1100221774 12:92512291-92512313 GAAGGTAGACTGGAGGAGGAAGG - Intergenic
1100307467 12:93364108-93364130 GAAGAGATAGTGAAGGATGAAGG + Intergenic
1101226141 12:102689932-102689954 GAAGTTTTACTGAAGCAGAGTGG - Intergenic
1101711753 12:107273965-107273987 GAAGATTTCCTGGAGGAAGTGGG - Intergenic
1104133665 12:125917737-125917759 GAAGATGTCCTGAGGGAGGAGGG + Intergenic
1104391297 12:128392602-128392624 GAAGACTTCCTGGAGGAGGTGGG + Intronic
1105365641 13:19761902-19761924 GAAGTTTCTCTGAAGGGGGATGG - Intronic
1105717710 13:23083976-23083998 GTATATTTAATGAAGGAGAAAGG + Intergenic
1105899476 13:24743085-24743107 GAAGATGCACAGCAGGAGGAGGG - Intergenic
1106397727 13:29397316-29397338 GAAGAGGGACTGCAGGAGGAAGG - Intronic
1106652326 13:31704780-31704802 GAAGATTTTATGAAGGAGGTGGG + Intergenic
1107140564 13:36994254-36994276 GAAGATTCACTGAAAGAGAAAGG - Intronic
1107206063 13:37790340-37790362 GAAAATATTCTAAAGGAGGAGGG + Intronic
1108857792 13:54816918-54816940 GAAGATTTTGTGAAGTATGAAGG + Intergenic
1109093781 13:58084658-58084680 TCATATTTACTCAAGGAGGAAGG - Intergenic
1109827860 13:67746313-67746335 CAACATTTTCTGAAGGAAGAAGG + Intergenic
1109977904 13:69865517-69865539 AAAAATTTACTGAAGAGGGACGG + Intronic
1113509087 13:110837755-110837777 GAAGGATTAGTGAAAGAGGAAGG - Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114527402 14:23375446-23375468 GAAAATTTAATAAAGGAGGGAGG + Intronic
1115480506 14:33856513-33856535 GTAGTTTTACTCAAAGAGGAGGG + Intergenic
1117652186 14:57918642-57918664 GAAAATTTGCAGAACGAGGAAGG + Intronic
1119829808 14:77692025-77692047 GAAGATTTTCTTAAGGGGAAAGG - Intronic
1120682939 14:87502544-87502566 GAAGTTTTGCTGGAAGAGGAAGG - Intergenic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1124366407 15:29074563-29074585 GAAGACATTCTGAAGGTGGATGG + Intronic
1126479245 15:49099603-49099625 GAAGATAAACTGAAGGGGAAAGG + Intergenic
1128028465 15:64459953-64459975 CAAGATTTAGTGATAGAGGATGG + Intergenic
1128502696 15:68238730-68238752 GAAGATATACTTTAGGAGGAAGG + Intronic
1129707012 15:77800083-77800105 GAAGGCTTCCTGATGGAGGAGGG + Intronic
1130512914 15:84604054-84604076 GAAGCTGTGCTGCAGGAGGATGG + Exonic
1131274010 15:90965442-90965464 ACAGCGTTACTGAAGGAGGATGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132984846 16:2759979-2760001 GAAGGCTTCCTGAAGGAGGTGGG + Intronic
1133088905 16:3388328-3388350 AAAGACTTGCTGAAGGAGGAGGG - Intronic
1133203483 16:4218815-4218837 GCAGAGTTAGTTAAGGAGGAAGG + Intronic
1133987618 16:10680375-10680397 GAAGAATGAATGAAGGAGGAAGG - Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135534109 16:23279426-23279448 GAAAACTTACACAAGGAGGAGGG + Intronic
1136585260 16:31180362-31180384 GAAGAGTAACTGGAGGAGGCTGG + Intronic
1137357355 16:47779647-47779669 GAACATTTCCTGGAGGAGGTGGG - Intergenic
1137631332 16:49947895-49947917 GAGGATATACTGGAGTAGGATGG + Intergenic
1138370659 16:56524059-56524081 GGAGATTCACTGCAGGAGGCAGG - Intergenic
1138791788 16:59912943-59912965 TAAGATTTCATCAAGGAGGAAGG + Intergenic
1138795962 16:59969262-59969284 GAAGAATTCCTGAAGGATGCTGG - Intergenic
1139181822 16:64757633-64757655 CAAGATGTACTGAAGGATGCTGG + Intergenic
1139322781 16:66128970-66128992 GGAGATTTATTTAAGGAAGAAGG + Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1140248206 16:73270532-73270554 GATGATTGACTGAAGCAAGATGG + Intergenic
1140388261 16:74561794-74561816 GAAGATTTACGGATTCAGGAAGG - Intronic
1142947463 17:3444030-3444052 AACAATTTACTCAAGGAGGAGGG - Intronic
1144017560 17:11210538-11210560 GAAGAACAACTGCAGGAGGAAGG - Intergenic
1144282629 17:13741952-13741974 GAAGGTTTCCTGAAGAAAGAGGG + Intergenic
1144519088 17:15942539-15942561 GAAGGTTTCCTGATGGAGGTTGG + Intergenic
1144590982 17:16523590-16523612 GAAAATATTCTGAAGGTGGAGGG - Intergenic
1146758054 17:35450083-35450105 GAAGATTTACTGAAATGGAAAGG - Intergenic
1147134592 17:38427847-38427869 GAAGATTTAGTGCAGGGGGTGGG - Intergenic
1148716648 17:49720532-49720554 GAAGATATATACAAGGAGGATGG + Intronic
1148809897 17:50283724-50283746 GGAGAGTTTCTAAAGGAGGAAGG - Intergenic
1148826577 17:50398204-50398226 GGAGATTTCCTGAAGGACTAAGG - Intergenic
1148985602 17:51618174-51618196 GAAGCTTTAGTGAAGAAAGAGGG - Intergenic
1149192926 17:54085790-54085812 GAAGATGAGCTGAAGCAGGATGG + Intergenic
1149783557 17:59417166-59417188 AAAGAGTGACTGGAGGAGGAAGG - Intergenic
1150165130 17:62933904-62933926 GAACATCTATTCAAGGAGGAAGG - Intergenic
1150897708 17:69233697-69233719 GAAGATCTCCTGAAGAAGAATGG - Intronic
1151612201 17:75183297-75183319 GCAGACTTACTAGAGGAGGAAGG + Intergenic
1156307552 18:35892623-35892645 GAAGATCTACTCAAGGTGTATGG + Intergenic
1156967586 18:43114027-43114049 TAGGATTTAAGGAAGGAGGAAGG - Intronic
1158323286 18:56287171-56287193 GAAGATCTGCTGATGGAGGAGGG - Intergenic
1158518324 18:58149149-58149171 GAACATTTACTGAAGGTGGAGGG + Intronic
1158994389 18:62902515-62902537 GAATATTTAATGAAGGAGAGAGG - Intronic
1159002429 18:62986389-62986411 GGACATTTCCTGAAGGACGATGG + Intergenic
1159274225 18:66194278-66194300 GCAGATCTACAGAAGGAGGGTGG - Intergenic
1160661754 19:304398-304420 GAAGATTTCCTGCTGGAGGCAGG + Intergenic
1161701064 19:5795605-5795627 GAAGGCTTCCTGTAGGAGGAGGG + Intergenic
1163538915 19:17894877-17894899 GAGGTATTACTGGAGGAGGATGG + Exonic
1163779560 19:19239405-19239427 GAAGAGGTATAGAAGGAGGAGGG - Intronic
1167153943 19:47726642-47726664 GAGGATGTAAGGAAGGAGGAAGG - Intronic
1168285499 19:55330308-55330330 AAAGATTTGCTGAATGAGGCTGG - Intronic
925775068 2:7327082-7327104 GAAGATTTTCTGAAGCATTAGGG - Intergenic
927419203 2:22912426-22912448 TAATATTTACTGCATGAGGATGG + Intergenic
928063733 2:28141599-28141621 GAAGAATTCCAGAAGGAGCAAGG + Intronic
928197513 2:29226174-29226196 GAAGAGTTAAAGGAGGAGGATGG + Intronic
930013706 2:46956711-46956733 GAAGGCTTTCTGGAGGAGGAGGG + Intronic
930254275 2:49071525-49071547 GAAAATTTAATCCAGGAGGAAGG + Intronic
930544414 2:52748305-52748327 GATGATTTAATCATGGAGGAAGG + Intergenic
930641995 2:53862772-53862794 CAAGATTTACTAGAGGAGGAGGG - Intergenic
930896201 2:56449469-56449491 GAAAATTTAATGAAGGGGGGAGG - Intergenic
931642115 2:64391104-64391126 GAAGACTTATGGAAGGAGGTGGG + Intergenic
932078845 2:68692703-68692725 GAAGTGTTACTGCAGGAGGAAGG - Intronic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
932561621 2:72876927-72876949 GAATATATACTGAATGAAGAAGG - Intergenic
935088965 2:99875984-99876006 GAATAGTCACTGAAGGAGGAGGG - Intronic
935160689 2:100527117-100527139 AAATATTTACTGAAGGAGCCTGG - Intergenic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
936025321 2:109027276-109027298 GAAGACTTCTTGAAGGAGGGTGG + Intergenic
937058930 2:118967208-118967230 GAAGGTGTCCTGAAGCAGGACGG + Intronic
937467596 2:122148381-122148403 TAACATTTACTGAAGCATGAGGG + Intergenic
937953979 2:127408723-127408745 GAAGACTTCCTGGAGGAGGCGGG - Intergenic
938370753 2:130767036-130767058 GAAGTTTTCCTGAAGGGGAATGG - Exonic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939259123 2:139784122-139784144 GAAGTTTTACTCATGGTGGAAGG + Intergenic
940238287 2:151534484-151534506 GAAGATTACCTGAAGAAGGCTGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940819339 2:158334843-158334865 GAAGATTAACTAATGGTGGAGGG - Intronic
941105762 2:161350996-161351018 GAAGATTTACTAAGGGAGATTGG - Intronic
941488111 2:166106822-166106844 GAAGGGTCACTGCAGGAGGAAGG - Intronic
943522359 2:188968738-188968760 GAAGACTGACTGAATTAGGATGG - Intergenic
943847312 2:192668547-192668569 GAACAGTTACTGAAGGGAGAAGG + Intergenic
944593133 2:201236969-201236991 GAAGATTTAATTCAGGAGGGTGG - Intronic
945169796 2:206983517-206983539 GGAGAATTACTGAAGCAGGTGGG + Intergenic
946302309 2:218831385-218831407 GAAGAGTTTCTGAAGGAGTGGGG + Intronic
946801562 2:223422562-223422584 AAATATTTACTAAAAGAGGATGG + Intergenic
946960992 2:224985747-224985769 CAAGATTTGTTGAAGAAGGATGG - Intronic
947087057 2:226465350-226465372 GAAGCTTTAATGAAGGAAGAAGG - Intergenic
947212719 2:227722739-227722761 GGAGAATTAGTGAAAGAGGAAGG - Intergenic
948572421 2:238926050-238926072 GAAGAAAGTCTGAAGGAGGAAGG + Intergenic
948840889 2:240648337-240648359 GGAGATTCACTGGAGGAGAACGG + Intergenic
1168985313 20:2043386-2043408 GAAGAGACACTGAAGGAGAAAGG + Intergenic
1169397173 20:5242313-5242335 GAATATTTTTTGGAGGAGGAGGG - Intergenic
1169900289 20:10545794-10545816 GGAGATTTCTTGAAGCAGGAAGG - Intronic
1170661596 20:18346392-18346414 GAAACTGTACTGAAGGAAGAAGG + Intergenic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173761352 20:45563362-45563384 GAAGATTTAATGAAGTGGTACGG + Intronic
1175136627 20:56829163-56829185 GAAGAGCTTCTCAAGGAGGAGGG - Intergenic
1175137464 20:56835228-56835250 GAAGCCTTCCTGAAGGAGGCAGG + Intergenic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1176686311 21:9851327-9851349 GAATATTTTCAGAAGAAGGAAGG - Intergenic
1177384783 21:20394489-20394511 GGTGATTTTCTGAAGGAGAATGG + Intergenic
1177509465 21:22065740-22065762 GGAGACTTCCTGAAAGAGGAAGG + Intergenic
1179086995 21:38226848-38226870 GAAAATGCACTGAAGGAGGATGG - Intronic
1179389740 21:40976917-40976939 GACCCTTTAGTGAAGGAGGAAGG + Intergenic
1179932063 21:44577431-44577453 GAAGCTTTACTCATGGTGGAAGG + Intronic
1181027624 22:20134899-20134921 GAAGGCTTCCTGAAGGAAGAGGG - Intronic
1182849749 22:33462384-33462406 AAAGATATACTTCAGGAGGAAGG + Intronic
1184731410 22:46373016-46373038 GTAGATGTAGTGGAGGAGGATGG + Exonic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
950854442 3:16091986-16092008 GAAGAATGACTGCAGGAGTAGGG + Intergenic
951413493 3:22394888-22394910 GAAGTTATACTGAAGAAGTAGGG - Intergenic
951655533 3:25003699-25003721 GAGTATTTACTGAAGATGGATGG + Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
952177754 3:30884795-30884817 AAATATTTATTGAGGGAGGAAGG + Intronic
952184454 3:30953674-30953696 GAAGGTTTACTGAATGTGGCAGG + Intergenic
952333443 3:32385285-32385307 AAAGTTTTACTGAGAGAGGAAGG - Intergenic
953102461 3:39842915-39842937 CAAGAATTACTGGAGGAGGCTGG - Intronic
953833771 3:46325798-46325820 GAAGATTTGCTCAAGGCAGAAGG + Intergenic
954148295 3:48645168-48645190 GAAGAAGTAGTGCAGGAGGATGG + Exonic
955083547 3:55679954-55679976 GAAGAATGAAAGAAGGAGGAAGG - Intronic
958876369 3:99622216-99622238 GAAGATATATTGCAGGAGGAAGG + Intergenic
959518353 3:107296792-107296814 AAATAATTACTGAAAGAGGAAGG + Intergenic
959720531 3:109482148-109482170 TAGGGTTTATTGAAGGAGGAAGG + Intergenic
960448364 3:117776040-117776062 GAAGGTTTACTGGGGTAGGAGGG + Intergenic
960868037 3:122221838-122221860 GAAGATTTAATGAACAAGTATGG + Intronic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964805215 3:160602172-160602194 TGAGGTTCACTGAAGGAGGAGGG - Intergenic
966108749 3:176370320-176370342 GAAGAATTAGTGAAAGAAGAAGG - Intergenic
966181161 3:177189746-177189768 AAAAATTTACTGAAGGGAGATGG + Intronic
966266835 3:178056342-178056364 CAAGATTTACTGATGAAGGCTGG - Intergenic
967337898 3:188364613-188364635 GAAGACTTTCTGGAGGAGGAGGG + Intronic
967818663 3:193819797-193819819 GAAGCTTGACTGAAGAAGGCAGG - Intergenic
967878594 3:194283044-194283066 GAACACTTGCTGAGGGAGGAAGG + Intergenic
968224148 3:196962482-196962504 GGAGGATTACTGAAAGAGGAAGG + Intronic
969495528 4:7524008-7524030 GGAGATTTAATGAAGTAGGCAGG + Intronic
969846940 4:9926768-9926790 GAAGTCATACTGTAGGAGGATGG + Intronic
969954887 4:10878883-10878905 GGAGAATTAATGAAGGAAGAAGG + Intergenic
969995932 4:11313265-11313287 GAATATTTAGTGAAGCAGAAAGG + Intergenic
971526391 4:27623936-27623958 GAAGTTATACTGAAGTAGGATGG + Intergenic
971765411 4:30824536-30824558 CAAGAATTACTGAAGGACAAAGG + Intronic
971767528 4:30852622-30852644 GAAAAATCCCTGAAGGAGGAAGG + Intronic
971804926 4:31344451-31344473 GAAGAGTTTATGAAGGAAGAGGG - Intergenic
972050583 4:34727767-34727789 GATGTTTTCCTGGAGGAGGAGGG + Intergenic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
975166432 4:71182945-71182967 GGAGAATTCCTGCAGGAGGAAGG + Intergenic
975318168 4:72978995-72979017 GAGGATATACTGAAGTAGGGTGG + Intergenic
975356580 4:73412748-73412770 GAAGATTTTTTGAGGGAGGTAGG + Intronic
976771870 4:88662028-88662050 GAACATCTACTGAGGGATGAAGG + Intronic
978069067 4:104443850-104443872 AAAGAATTACTGAAAGAGGGAGG - Intergenic
979204209 4:118015732-118015754 GTATGTTTACTGAAGAAGGAAGG + Intergenic
979848705 4:125549522-125549544 AAATATTTAGAGAAGGAGGAAGG + Intergenic
980640460 4:135570711-135570733 GAAGACTCTCTGAAGAAGGACGG + Intergenic
981081346 4:140642210-140642232 GAAGAATTCCTGAAGGAGAGTGG - Intronic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
981689414 4:147490399-147490421 GAAGATTGACAAAAGCAGGAAGG + Intronic
983907750 4:173202578-173202600 TAAGATTTCCTGGAGGAGGCAGG - Intronic
984720619 4:182969773-182969795 GAAGATTAAGTGGAGGAGCATGG - Intergenic
984924527 4:184794925-184794947 GAGGATTTGCTGAAGAGGGACGG + Intronic
985545076 5:505288-505310 GAAGAGTGACTGTAGGAGGGTGG + Intronic
985545113 5:505409-505431 GAAGAGTGACTGTAGGAGGGTGG + Intronic
986376968 5:7142177-7142199 GAAGATTTCCTGAGGGAGTGAGG - Intergenic
986444969 5:7813284-7813306 GAATATTTATGGAAGGAAGAGGG + Intronic
986837006 5:11650214-11650236 GAAGAGAGAGTGAAGGAGGAGGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987060013 5:14233523-14233545 AAATATTTACTAAAGGAGAAGGG - Intronic
987123316 5:14788263-14788285 GGAGGTTTCCTGAGGGAGGAAGG - Intronic
987444678 5:18003078-18003100 GAAAATTTTCTGGAGGAGCAAGG - Intergenic
988204370 5:28115316-28115338 GAAAGTTTGCTGAAGGAGTAGGG - Intergenic
988401712 5:30770093-30770115 AAAGATTAACTTAAGGAGAATGG - Intergenic
988629757 5:32916418-32916440 GTAGATTAACAGAATGAGGATGG + Intergenic
989201463 5:38768738-38768760 GAAGATTTATGTCAGGAGGAAGG + Intergenic
990050668 5:51495399-51495421 GAAGACTTGTTGGAGGAGGATGG - Intergenic
990145690 5:52757599-52757621 GAAGATTTAATTAAGTAAGAAGG + Intergenic
990495645 5:56345178-56345200 GAAGCTTTACTGCTGGAGAAAGG - Intergenic
990753928 5:59047109-59047131 GAAGATACAATGGAGGAGGAAGG - Intronic
990847326 5:60157486-60157508 GAAGATTTAGAGAATGAGGAGGG + Intronic
992832474 5:80607649-80607671 GTAGATTCACTGAAGTAGGAAGG + Intergenic
993061807 5:83047638-83047660 GAAGATTCATGGTAGGAGGAGGG + Intergenic
993490972 5:88548631-88548653 GAAAATTGACTGAAGGTGGAGGG - Intergenic
993927708 5:93891317-93891339 GAAGTATTATTGAGGGAGGAGGG - Intronic
996474626 5:123902723-123902745 AAATATTTATTGAATGAGGAAGG + Intergenic
996724047 5:126658326-126658348 GAAGATTGACTGGAGTTGGATGG - Intergenic
996788147 5:127263279-127263301 TAAGATTTGGTGAAGGAAGAGGG + Intergenic
997834042 5:137178005-137178027 GGAGATTTCCTGAAGGAAGCCGG - Intronic
997866633 5:137469714-137469736 GAGCATTTACTCAAGGAGAACGG - Intronic
998306963 5:141087943-141087965 GAAAATATCCTGAATGAGGATGG + Intergenic
998530424 5:142879552-142879574 TAAGATTTTCTGAAGAAGGTGGG - Intronic
998868534 5:146529894-146529916 GAAGTTTTACTGAATGGTGAAGG - Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1000131050 5:158300055-158300077 TAAGCTTGACTGAAGGAGAACGG - Intergenic
1000700139 5:164439338-164439360 GAAGTATGTCTGAAGGAGGAGGG + Intergenic
1000802047 5:165739929-165739951 GGAGATTGGGTGAAGGAGGAGGG + Intergenic
1000830068 5:166092190-166092212 GAATATTTACTTATGGTGGAAGG + Intergenic
1004397101 6:15254949-15254971 GGAGAATTACTTGAGGAGGATGG + Intronic
1005018257 6:21394008-21394030 GAAGAAATACTGAAGAAGGGAGG - Intergenic
1005036035 6:21555643-21555665 GAAGATTTAAGGCAGGAGGAAGG + Intergenic
1006235591 6:32628138-32628160 AAATATTTAGTGATGGAGGAAGG + Intergenic
1006431950 6:34002539-34002561 GAAGGCTTCCTGAAGGAGGTAGG + Intergenic
1007106387 6:39285991-39286013 GAAGATAAACTTCAGGAGGATGG - Intergenic
1007836883 6:44680903-44680925 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1008335174 6:50295058-50295080 AAAGTTTCACTGAAGCAGGAAGG + Intergenic
1008600525 6:53089439-53089461 GAAGATTTTCAGAAGAAGCAAGG + Intronic
1008827572 6:55716110-55716132 GAAGACGTACTGGAGCAGGAGGG - Intergenic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1012017829 6:93874401-93874423 GAACCTTTACTGACTGAGGAAGG - Intergenic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1012783782 6:103597134-103597156 GAACATTTAAAGGAGGAGGAAGG + Intergenic
1013460584 6:110371497-110371519 GAAGGTTTAGTGAAGGGGGTGGG - Intergenic
1016616427 6:146053774-146053796 GCAGAATTACCTAAGGAGGAAGG - Intronic
1016758340 6:147711168-147711190 GAAGATTTAATGAAAGAGACTGG - Intronic
1018372714 6:163183074-163183096 GAAGAGTGAATGAATGAGGACGG + Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018979553 6:168592191-168592213 GAAGATTGAGAGAAGCAGGATGG - Intronic
1020153130 7:5699186-5699208 AAAATTATACTGAAGGAGGAGGG - Intronic
1020414700 7:7932672-7932694 GAAGATTTCATGTAGAAGGAGGG - Intronic
1021240384 7:18193466-18193488 GGAGATTTACTGAAGTAAAAGGG + Intronic
1023024958 7:36041937-36041959 GAGGATCTAGTGAAGGAGCAGGG + Intergenic
1023361431 7:39420056-39420078 GCAGATTTACTGAAGGCAGATGG - Intronic
1023375165 7:39548680-39548702 GAAGATTAATGGAAGGAGAAGGG - Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023771846 7:43564004-43564026 GAATATTTACTGAGACAGGATGG + Exonic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1025823713 7:64994379-64994401 GAAAATATATTGAAGGAGGATGG - Intronic
1027543189 7:79493755-79493777 GCAGATTTACTGTTTGAGGAGGG - Intergenic
1027610472 7:80353658-80353680 GAAAAATTTCTGAAGGAGCAAGG + Intergenic
1028739977 7:94262906-94262928 GTAGACTTATTGAAGGAGGTAGG - Intergenic
1029623825 7:101707268-101707290 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1032089974 7:128906631-128906653 GAAGACTTTCTCAGGGAGGAAGG + Intronic
1032371824 7:131363134-131363156 GAAGAACTTCTGTAGGAGGAGGG + Intronic
1032385178 7:131517729-131517751 AAAGAGTTACGCAAGGAGGAAGG - Intronic
1032893816 7:136228340-136228362 GAAGATTTACTGAATGGGGCTGG + Intergenic
1033191469 7:139284313-139284335 GAAGATTTTTTGTAGGTGGAAGG - Exonic
1033529229 7:142246093-142246115 GAAGACACTCTGAAGGAGGATGG - Intergenic
1033560837 7:142528901-142528923 GAAGACTTCCCGAAGGCGGAGGG + Intergenic
1034659801 7:152759513-152759535 GAAGACTTACAGGAGGAGAAAGG + Intergenic
1035041029 7:155927286-155927308 GAAGAGTTACTCAAGGATGAAGG + Intergenic
1036773617 8:11595102-11595124 GAATATATACTGCAGGAGGGGGG - Intergenic
1037079680 8:14768729-14768751 GAACACTTACAGATGGAGGAAGG + Intronic
1037097510 8:15003193-15003215 TAAAATTTACTGAAGGAAAATGG + Intronic
1037097648 8:15004638-15004660 TAAAATTTACTGAAGGAAAATGG - Intronic
1037283986 8:17276225-17276247 GAAGACAGACTGAAGGAAGAAGG + Intronic
1037385553 8:18336536-18336558 GAAGATTTACTTAAGGGCAAAGG + Intergenic
1038893718 8:31756775-31756797 TAAGAGTTTCTGAAGGAAGAAGG + Intronic
1042192915 8:66206061-66206083 GAATATTTAGGGAAGGAGGCAGG + Intergenic
1043334537 8:79158543-79158565 GAAGATTTGCTGAAAGACAATGG - Intergenic
1043815774 8:84799414-84799436 AAAGAAATACTGAAGAAGGAAGG + Intronic
1044373948 8:91447181-91447203 GAACATCTAGTGAAGTAGGAAGG + Intergenic
1044621923 8:94198971-94198993 GAAGATTTCATGAAGGAAGTAGG - Intronic
1045019282 8:98027704-98027726 GAAGTTTTACCCAAGGAGAAGGG + Exonic
1045472400 8:102524187-102524209 GAAGAATTAGTAATGGAGGATGG - Intergenic
1045866039 8:106866691-106866713 GAAGATTAATTGCTGGAGGAAGG + Intergenic
1046653296 8:116864208-116864230 GAAAATTTACTGAAAGAACAAGG + Intronic
1052496180 9:29228132-29228154 GTAGCTATACTGAAGGTGGAAGG - Intergenic
1052856051 9:33407250-33407272 GAAGGCTTCCTGAAGGAAGAGGG + Intergenic
1053346177 9:37380032-37380054 AAAGGTTTACTGAATGAAGAAGG + Intergenic
1055472450 9:76626573-76626595 GAAAAGTTACTTCAGGAGGAAGG - Intronic
1058902575 9:109455358-109455380 GAATATTTACTGAGGGATGATGG - Intronic
1059265648 9:113027381-113027403 GTAAAATTACTGAAGTAGGAAGG + Intergenic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1187568100 X:20473237-20473259 GAAGACTTCATGAAGGAGGTAGG + Intergenic
1187629231 X:21149813-21149835 TATGATTTACTGAAATAGGAGGG - Intergenic
1187992239 X:24887268-24887290 GGAGAGTAACTGAAGAAGGAAGG + Intronic
1189262068 X:39686382-39686404 GGACATTCTCTGAAGGAGGATGG + Intergenic
1190037349 X:47037969-47037991 GGAGATAGACTGTAGGAGGATGG - Intronic
1193509876 X:82385736-82385758 GAAAATATTCTGAAGGAAGAAGG + Intergenic
1194091008 X:89581877-89581899 GAAAATATATTGAGGGAGGATGG - Intergenic
1194619542 X:96152726-96152748 GAAAATTTAGTGAATGAAGAAGG + Intergenic
1196535838 X:116842992-116843014 GAAGACTTATTCAAGGATGAGGG + Intergenic
1196614535 X:117752849-117752871 CAAGAATGACTGAAGGAAGAAGG + Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1198316447 X:135471510-135471532 GAAGAAGGACTGAAAGAGGAAGG - Intergenic
1198371341 X:135992237-135992259 GAAGATTTAGTGACTGAGGAAGG - Intronic
1200443656 Y:3237940-3237962 GAAAATATATTGAGGGAGGATGG - Intergenic
1202345374 Y:23917804-23917826 AATTATTTTCTGAAGGAGGAGGG - Intergenic
1202525396 Y:25752285-25752307 AATTATTTTCTGAAGGAGGAGGG + Intergenic