ID: 1012470873

View in Genome Browser
Species Human (GRCh38)
Location 6:99571006-99571028
Sequence GATGTTAAGCTATGCTGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012470873_1012470875 27 Left 1012470873 6:99571006-99571028 CCTAATCAGCATAGCTTAACATC No data
Right 1012470875 6:99571056-99571078 CCCATAAAGTCCCATAAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012470873 Original CRISPR GATGTTAAGCTATGCTGATT AGG (reversed) Intergenic
No off target data available for this crispr