ID: 1012470875

View in Genome Browser
Species Human (GRCh38)
Location 6:99571056-99571078
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012470871_1012470875 29 Left 1012470871 6:99571004-99571026 CCCCTAATCAGCATAGCTTAACA No data
Right 1012470875 6:99571056-99571078 CCCATAAAGTCCCATAAAGTCGG No data
1012470873_1012470875 27 Left 1012470873 6:99571006-99571028 CCTAATCAGCATAGCTTAACATC No data
Right 1012470875 6:99571056-99571078 CCCATAAAGTCCCATAAAGTCGG No data
1012470872_1012470875 28 Left 1012470872 6:99571005-99571027 CCCTAATCAGCATAGCTTAACAT No data
Right 1012470875 6:99571056-99571078 CCCATAAAGTCCCATAAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012470875 Original CRISPR CCCATAAAGTCCCATAAAGT CGG Intergenic