ID: 1012475410

View in Genome Browser
Species Human (GRCh38)
Location 6:99611290-99611312
Sequence CATTGAGCTGAGTCATTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012475406_1012475410 12 Left 1012475406 6:99611255-99611277 CCCCTCATTTTAAGAAAAAAGCT 0: 1
1: 0
2: 1
3: 51
4: 467
Right 1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG No data
1012475407_1012475410 11 Left 1012475407 6:99611256-99611278 CCCTCATTTTAAGAAAAAAGCTT 0: 1
1: 0
2: 4
3: 80
4: 694
Right 1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG No data
1012475405_1012475410 13 Left 1012475405 6:99611254-99611276 CCCCCTCATTTTAAGAAAAAAGC 0: 1
1: 0
2: 1
3: 50
4: 400
Right 1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG No data
1012475408_1012475410 10 Left 1012475408 6:99611257-99611279 CCTCATTTTAAGAAAAAAGCTTA 0: 1
1: 0
2: 1
3: 52
4: 635
Right 1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012475410 Original CRISPR CATTGAGCTGAGTCATTCTG CGG Intronic
No off target data available for this crispr