ID: 1012475621

View in Genome Browser
Species Human (GRCh38)
Location 6:99613199-99613221
Sequence CGGTCTCTCCCCAAAACCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012475619_1012475621 -6 Left 1012475619 6:99613182-99613204 CCAGCGGCTGATGGCCTCGGTCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 148
1012475614_1012475621 7 Left 1012475614 6:99613169-99613191 CCAAGGCGCCGTCCCAGCGGCTG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 148
1012475611_1012475621 25 Left 1012475611 6:99613151-99613173 CCACGAACACGCGGCTCGCCAAG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 148
1012475616_1012475621 -1 Left 1012475616 6:99613177-99613199 CCGTCCCAGCGGCTGATGGCCTC 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 148
1012475618_1012475621 -5 Left 1012475618 6:99613181-99613203 CCCAGCGGCTGATGGCCTCGGTC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012475621 Original CRISPR CGGTCTCTCCCCAAAACCCC CGG Exonic
901083981 1:6599581-6599603 CACCCTCTCCCCAAAAGCCCAGG + Intronic
901342840 1:8510963-8510985 CGGTCTGTTCTCAAAACCCTGGG + Intronic
901595568 1:10382826-10382848 CTGTTTCTCCCCAAACACCCAGG - Intergenic
901792712 1:11662737-11662759 AGGTCTCTCCCTAAACACCCAGG - Exonic
902394076 1:16122896-16122918 CTGTATCTCCCCAAAGCTCCAGG + Intergenic
902578609 1:17394285-17394307 CGGTCTCTCCCCCAGAGCCCTGG + Exonic
902601213 1:17540858-17540880 CCCTCTCTCCCCAGAACCCGAGG - Intronic
903193392 1:21668892-21668914 CAGTCCCTCCTCTAAACCCCAGG + Intronic
905009287 1:34736348-34736370 AGCTTTCTCCCCAAAGCCCCTGG - Intronic
906074980 1:43045466-43045488 CGGCCTTAGCCCAAAACCCCAGG - Intergenic
907409817 1:54276001-54276023 CGTTCTCTCCCCATAACCAATGG + Intronic
911436474 1:97865775-97865797 ATGTCTCTGCCTAAAACCCCAGG + Intronic
915448239 1:155987100-155987122 CAGCCTCTCCCCCAAACCACAGG + Intronic
915554140 1:156652126-156652148 CGGTCTCTTCCCTATTCCCCAGG + Intronic
916681480 1:167109077-167109099 TGGTCCTTCCCCAATACCCCTGG - Intronic
921075444 1:211696871-211696893 CTTTCTCTCCCCAAAAGCCATGG - Intergenic
922220275 1:223553077-223553099 TGGTCTCCCCCCACCACCCCGGG - Intronic
923106330 1:230856786-230856808 CCATATCTCCCCAAAACTCCAGG + Intronic
1063218930 10:3948588-3948610 TGGTGTCTTCCCAACACCCCAGG + Intergenic
1067847581 10:49736218-49736240 CGGTATGTCCCCAGCACCCCCGG + Intronic
1067912572 10:50361326-50361348 CTGTCTCTCCTCATACCCCCAGG + Intronic
1069892170 10:71658772-71658794 CGGTCTGACCCCAAAGCCCCTGG + Intronic
1073323952 10:102631840-102631862 CAGTCTCTCCCAAATACTCCAGG - Exonic
1073618412 10:105022030-105022052 CCCTCTTTCCCCACAACCCCTGG - Intronic
1075637566 10:124039735-124039757 CTGTCTCTCCTCAAACCCTCAGG - Intronic
1076108803 10:127845681-127845703 CAGCCTCTCCCCCAAGCCCCTGG - Intergenic
1076295175 10:129378424-129378446 AGTTCTCTCCCCGAAGCCCCAGG + Intergenic
1076672830 10:132132623-132132645 CCGTCTCACCCCAAAAGCCTTGG + Intronic
1077184847 11:1231397-1231419 CGGCCTCTCCCCCACACTCCCGG + Intronic
1079730966 11:23937544-23937566 CGGGCTATCCCTAAAACCCTTGG + Intergenic
1080829487 11:35878076-35878098 AGGTCTCTCCCTAAACACCCGGG - Intergenic
1083574408 11:63779321-63779343 CAGGCTCTCCCCGCAACCCCGGG - Intergenic
1083592885 11:63905526-63905548 AGGTTTCACCCTAAAACCCCCGG - Intronic
1083605282 11:63974985-63975007 AGGTCTTTCCCCACAGCCCCAGG + Intronic
1084857472 11:71998194-71998216 CTGTCTCTCTCAGAAACCCCAGG + Intergenic
1085291081 11:75399905-75399927 CCTTCTCTTCCCAAAACCACGGG - Intronic
1088186480 11:107176801-107176823 CGGTCACTCCCAAGAACCCGTGG + Intergenic
1089350402 11:117818763-117818785 GAGTTTCTCCCCACAACCCCAGG + Intronic
1090759216 11:129821147-129821169 CAGTCTTTCCCCCAACCCCCTGG + Intronic
1095582351 12:43814701-43814723 CTGTCTGACCCCAAAACCCAAGG - Intergenic
1096039955 12:48506508-48506530 CCCTCCCTCCCCACAACCCCTGG - Intergenic
1099610517 12:84862491-84862513 CGTTCTCTCACCAAAACCCTTGG - Intronic
1099974545 12:89532833-89532855 TGCTCTCTCCCCACAGCCCCTGG - Intergenic
1100681308 12:96925252-96925274 TGGTCCCTCCCCAAAAACCCAGG - Intronic
1102972429 12:117180192-117180214 CAGTCTTTCTCCAAAAACCCTGG + Intronic
1104718504 12:131031750-131031772 CCTTGTCTCCCCAAAACCTCAGG + Intronic
1106357051 13:28992885-28992907 CCATCTCTCCCCACAGCCCCTGG + Intronic
1112670274 13:101627620-101627642 CCCTCTCTCCCTACAACCCCTGG + Intronic
1115383692 14:32770561-32770583 CTGTCTCTCCCCAACACACCAGG + Intronic
1117013110 14:51491023-51491045 TGCCCTCTCCCCAAAACCCTGGG + Intronic
1118002395 14:61535816-61535838 CTGTTTCTCCCCACAACTCCTGG - Intronic
1118631171 14:67704691-67704713 AGGTCTCACCCCAAATCACCAGG + Intronic
1122199299 14:100112657-100112679 TGTTTTCTCCCCAAAACCTCAGG + Intronic
1124048477 15:26173335-26173357 AGGTCTCTCCCTTAAACACCTGG + Intergenic
1124861765 15:33448881-33448903 CGTTCTCTCCCCCACACTCCAGG - Intronic
1125242323 15:37589597-37589619 CCCTCCCTCCCCCAAACCCCTGG + Intergenic
1125328961 15:38564394-38564416 AGCTCCCTCCCCGAAACCCCGGG + Intronic
1125901162 15:43349082-43349104 CTGTCTCTCCCCCAATCCCCAGG + Intronic
1129846593 15:78770624-78770646 CGGTCTCCCCCCATACCCCTCGG - Intronic
1130599651 15:85266676-85266698 CGGTCTCCCCCCATACCCCTCGG - Intergenic
1131903497 15:97115425-97115447 GGCTGTCTCCCCAAAAGCCCCGG - Intergenic
1133004838 16:2874111-2874133 CAGTCACTCCCCCAAGCCCCTGG + Intergenic
1135679131 16:24441942-24441964 CTGTCTCTCCCCACACCCCCTGG + Intergenic
1136595866 16:31249444-31249466 CAGCCTCTCCCCAAACCCCAAGG + Intergenic
1137783349 16:51116045-51116067 AAATCTCTCCCCAAGACCCCGGG + Intergenic
1138230001 16:55329826-55329848 CTGTGTCCCACCAAAACCCCTGG + Intronic
1138536658 16:57663870-57663892 TGGTCTCTCCTTACAACCCCTGG + Exonic
1139511893 16:67432349-67432371 TGGTCTCTCGCCAATACCCACGG + Intronic
1140477840 16:75247874-75247896 TGTTCTCTGCCCAAGACCCCAGG + Intronic
1142286075 16:89172041-89172063 CACTCACTCCCCACAACCCCTGG - Intronic
1142813478 17:2407641-2407663 AGATCTCTCCCCAAGGCCCCAGG + Intronic
1143010100 17:3861599-3861621 GGGCCTCTCCCCGAACCCCCAGG + Intronic
1143291189 17:5830450-5830472 TGGTCTCACCCCAAACTCCCAGG - Intronic
1143502806 17:7348787-7348809 CCGTCTCTCCCCCACACCCTAGG + Intronic
1143814640 17:9502296-9502318 TCATCTCTCCCCCAAACCCCAGG - Intronic
1148484926 17:47984522-47984544 CAGTTTCTCCCCAGAAACCCAGG + Intergenic
1151814981 17:76467404-76467426 CGCTCTCTTCCCCAAACCCTGGG + Intronic
1152754797 17:82082719-82082741 CGGTCTCTTCCCTACACGCCGGG + Intronic
1155063778 18:22251403-22251425 GTGTTTCTCCCCAAAACCCTGGG + Intergenic
1155191922 18:23437883-23437905 CGGTGCCTGCCCAAATCCCCTGG + Exonic
1157166003 18:45359050-45359072 CTGACTCTCCCCAAAACTCTAGG - Intronic
1157556014 18:48613325-48613347 CAGTCTCTCCCTCTAACCCCTGG - Intronic
1160610130 18:80078132-80078154 CGGTCTTTCCCCAACAGCCGAGG - Intronic
1160807511 19:998995-999017 CGGTGTCTCCCCAGATCCCGCGG - Intergenic
1160809454 19:1007164-1007186 CTGTTTCTCCCGAAAACCCTGGG - Intronic
1161380367 19:3961600-3961622 GTGTCTCTGCTCAAAACCCCAGG - Intronic
1161744891 19:6050111-6050133 TGGTTTTTCCCCAAGACCCCTGG - Intronic
1164765445 19:30762342-30762364 CCATCTCACCCCACAACCCCTGG + Intergenic
1165433571 19:35785167-35785189 CTGTTTCTCCCCCAAACCGCAGG + Exonic
1166828908 19:45626675-45626697 CAGCCTGTCCCCCAAACCCCTGG + Intronic
1168313979 19:55476084-55476106 CGGTCTCCCACTAAAACCCTAGG + Intergenic
1168326415 19:55540955-55540977 ACGGCGCTCCCCAAAACCCCAGG + Exonic
928104113 2:28456694-28456716 CCCTCCCTCCCCACAACCCCTGG + Intergenic
931654712 2:64500514-64500536 CAGTCTCTCCACAAAAACCTAGG - Intergenic
933271809 2:80240775-80240797 CTGTCTCTTCCTAAAAACCCAGG - Intronic
937377936 2:121350497-121350519 CAGTCTCTTCCCAGAGCCCCAGG - Intronic
938317482 2:130340100-130340122 CGGTCTCCACCCAGAACCCCTGG - Intronic
939428450 2:142071817-142071839 CCTTCTCTCTCCAAAACCTCAGG + Intronic
940782339 2:157946024-157946046 CTTTCTCTCCCCACAACCCTAGG + Intronic
947711492 2:232318912-232318934 CCGTCTCTCCCTGAAACCCCAGG + Intronic
1173866209 20:46314044-46314066 CTGTCTCACCCCACCACCCCAGG - Intergenic
1174358590 20:50014426-50014448 CGGTCTCTGCCCACACTCCCTGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175710243 20:61214481-61214503 CTGTCTCTCCCCTGAGCCCCTGG + Intergenic
1177550961 21:22621858-22621880 CGGTGTCCTCCCAAATCCCCAGG - Intergenic
1179056506 21:37940644-37940666 CCCTCCCTCCCCCAAACCCCTGG + Intergenic
1180184642 21:46133418-46133440 CGGCCTCTCCCCAGCATCCCAGG + Intergenic
1182307441 22:29380394-29380416 CAACCTCTCCCCAGAACCCCCGG + Intronic
1182669994 22:31987631-31987653 TGGTCTCTCCCCAAGCCCCAAGG - Intergenic
1182759222 22:32708603-32708625 CCCTCTCTCCCCAAACCACCGGG - Intronic
1183524592 22:38315951-38315973 CAGTCGCTCCCCAACACCCCAGG + Intronic
1183655277 22:39180801-39180823 CTGGCTCTCCCCAAAAAGCCAGG + Intergenic
1185277354 22:49955533-49955555 GGGTCTGTGCCCAAAACCACAGG + Intergenic
949608450 3:5679295-5679317 AGGTCTCTCCCTAAACACCCGGG - Intergenic
955386271 3:58483599-58483621 CTGTATCGCCCCAAAACCCTAGG + Intergenic
966156452 3:176921989-176922011 TGCTCTCTCCCAACAACCCCTGG - Intergenic
967971152 3:195000446-195000468 CAGGCTCTCCCCAAAACCCCAGG + Intergenic
969431013 4:7154394-7154416 GGGTCCCTCCCCCAACCCCCGGG - Intergenic
984583072 4:181533045-181533067 AGTGCTTTCCCCAAAACCCCGGG - Intergenic
984621982 4:181964085-181964107 AGGTCTCTCCCAAAAGTCCCCGG + Intergenic
984849970 4:184144521-184144543 GGGTCTCTCCAGAGAACCCCAGG - Intronic
985161225 4:187047007-187047029 CCCTCCCTCCCCAAAAACCCTGG - Intergenic
985442946 4:189997702-189997724 GGGTCTCTCCCCCAAAACCTGGG + Intergenic
985689298 5:1298346-1298368 CCGCCTCTTCCCAGAACCCCTGG + Intergenic
985849805 5:2380682-2380704 TGCTCCCTCCCCAGAACCCCTGG - Intergenic
988652469 5:33167369-33167391 CGGTCTTTCCCCAATCCCACTGG + Intergenic
989506553 5:42232217-42232239 TTATCTCTCCCCAAAACTCCTGG + Intergenic
998467327 5:142356712-142356734 CCGTCCCTCCCCCCAACCCCAGG - Intergenic
999255196 5:150206065-150206087 GAGTCCCTCCCCAAAACCCTAGG - Intronic
1001416167 5:171545960-171545982 CGGTCTCAATCCAAAACCCAGGG + Intergenic
1001667923 5:173448793-173448815 CATTCTCTCCCCCAAACTCCTGG - Intergenic
1002159640 5:177307656-177307678 CGGCCTCACCCCCAAACACCAGG + Exonic
1004985126 6:21072990-21073012 CCCTCTCTTCCCCAAACCCCTGG + Intronic
1005360159 6:25023955-25023977 CGGTCACTCCCAAGAACCCGTGG - Intronic
1006672560 6:35738362-35738384 CCATCTCTCCCCAATACTCCAGG + Exonic
1010960357 6:82138409-82138431 AGGTCTCTCCACAAAACCCGGGG - Intergenic
1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG + Exonic
1014570186 6:122997795-122997817 CGGTCTCTCCCCTGAGACCCTGG + Exonic
1018284711 6:162224940-162224962 CTGTCTCTCCCAAGAACACCAGG - Intronic
1019664054 7:2242435-2242457 TTGTCTCTCTCCCAAACCCCCGG - Intronic
1028522420 7:91747151-91747173 CTGGATCTCCCCAAATCCCCAGG + Intronic
1029616929 7:101665002-101665024 CAGTCTCTTCCCCCAACCCCAGG + Intergenic
1031643057 7:124189646-124189668 CAGTGGCTGCCCAAAACCCCTGG + Intergenic
1032567029 7:132957171-132957193 CGGTTTATTCCCAAAACCCCTGG + Intronic
1035277710 7:157758017-157758039 CTGTCCCTCCCGCAAACCCCTGG - Intronic
1037521488 8:19684504-19684526 GGGTGACTCCCCATAACCCCAGG + Intronic
1038748359 8:30273729-30273751 CGGTCTCTCCCAAAACACCTGGG - Intergenic
1039831596 8:41219664-41219686 GGTTCTCTCCCCAAAATCTCTGG + Intergenic
1041502024 8:58549424-58549446 CTGCATCTCCCCTAAACCCCTGG + Intergenic
1043824452 8:84908748-84908770 GTGCATCTCCCCAAAACCCCCGG + Intronic
1048282312 8:133114397-133114419 AGGTCTGTCCCGACAACCCCTGG - Intronic
1049176075 8:141193479-141193501 CTGTCTCTTCCCAAAACACAAGG + Intronic
1052187405 9:25616007-25616029 CGCTTTCTCCCCAAAACACAGGG - Intergenic
1056499917 9:87198511-87198533 TGTTGTCTCCCCATAACCCCAGG - Intergenic
1058690812 9:107519117-107519139 CTATCCCTCCCCAGAACCCCCGG + Intergenic
1061358532 9:130124738-130124760 CGGTCTCTCCTCCAATCACCAGG - Intronic
1061420507 9:130470853-130470875 CGGTCACTCCCAAGAACCCGTGG + Exonic
1062133024 9:134910367-134910389 CGGTCTCTCCCCACGTCCCCTGG + Intronic
1185482284 X:455776-455798 CGGTCGCTCCCCAGTTCCCCCGG - Intergenic
1196800173 X:119535742-119535764 TTCTCTCTCCCCACAACCCCTGG - Intergenic
1197192063 X:123658683-123658705 CCCTCTCTCCTCACAACCCCTGG - Intronic
1199272783 X:145904689-145904711 AGGTCTCTCCCCAACACCTGGGG - Intergenic
1199863234 X:151820717-151820739 CAGTCTTGCCCCAAAACCCATGG + Intergenic