ID: 1012475729

View in Genome Browser
Species Human (GRCh38)
Location 6:99613581-99613603
Sequence AGCAGCAGCAAGCAAGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 566}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012475725_1012475729 -8 Left 1012475725 6:99613566-99613588 CCCTACCGGGAGGAGAGCAGCAG 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG 0: 1
1: 0
2: 8
3: 48
4: 566
1012475718_1012475729 26 Left 1012475718 6:99613532-99613554 CCTAGCGAGGGCGGCGGCGGCCG 0: 1
1: 0
2: 10
3: 38
4: 424
Right 1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG 0: 1
1: 0
2: 8
3: 48
4: 566
1012475724_1012475729 -7 Left 1012475724 6:99613565-99613587 CCCCTACCGGGAGGAGAGCAGCA 0: 1
1: 0
2: 0
3: 10
4: 236
Right 1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG 0: 1
1: 0
2: 8
3: 48
4: 566
1012475726_1012475729 -9 Left 1012475726 6:99613567-99613589 CCTACCGGGAGGAGAGCAGCAGC 0: 1
1: 0
2: 3
3: 25
4: 215
Right 1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG 0: 1
1: 0
2: 8
3: 48
4: 566
1012475720_1012475729 6 Left 1012475720 6:99613552-99613574 CCGCTCACGGCGACCCCTACCGG 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG 0: 1
1: 0
2: 8
3: 48
4: 566
1012475716_1012475729 30 Left 1012475716 6:99613528-99613550 CCGGCCTAGCGAGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG 0: 1
1: 0
2: 8
3: 48
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012475729 Original CRISPR AGCAGCAGCAAGCAAGGAGC CGG Exonic
900338755 1:2177801-2177823 CGCAGCAGCCAGGAAGAAGCAGG - Intronic
900490175 1:2944097-2944119 GGCAGCAGCCAGCCTGGAGCAGG - Intergenic
900519378 1:3098300-3098322 AGGAGCAGGGAGCAGGGAGCCGG - Intronic
900645280 1:3706189-3706211 ACCAGCAGTCAGCAAGGTGCAGG - Intronic
900840219 1:5042673-5042695 AGAAGGAGCCAGCAGGGAGCAGG - Intergenic
901289123 1:8108742-8108764 AGCAGAATCAAGGAAGGTGCAGG + Intergenic
902166353 1:14574977-14574999 AGCAGCAGGTAGAAAGGCGCAGG + Intergenic
902288815 1:15423543-15423565 CACAGCAGTAAGGAAGGAGCTGG - Intronic
902546307 1:17192858-17192880 AGCAGCAGCATGCAAGGTTGGGG + Intergenic
903259632 1:22124344-22124366 AACAGCAGGAAGAAAGGAGCTGG - Intronic
903276716 1:22226540-22226562 AAGAGCAGCATGCAAGGATCAGG - Intergenic
903377754 1:22877064-22877086 TGCAGCAGCAGGAAGGGAGCTGG + Intronic
903423802 1:23238207-23238229 AGCAGAAGAAACCAATGAGCAGG + Intergenic
903596743 1:24501426-24501448 AGAAGCAGCAAGCAGGAAGTAGG + Intergenic
903627778 1:24743994-24744016 AACAGCAGCAAACTAGGACCAGG + Intergenic
903655970 1:24948935-24948957 AGCAGCAGGAGGCAGGGAGGTGG - Intronic
904305389 1:29585531-29585553 AGCACCAGGAAGCAGGCAGCGGG - Intergenic
905014869 1:34770881-34770903 TGCAGAAGAAAGCAAGGAGGTGG - Intronic
905172445 1:36117081-36117103 GGCAGAGGCAAGCAAGCAGCTGG - Intronic
906041725 1:42793036-42793058 AGCAGCAGCAGCCCTGGAGCAGG + Intronic
906319000 1:44805302-44805324 TGCAGCAGCAAGGGCGGAGCAGG - Exonic
906495268 1:46301246-46301268 AGCAGCAGCATTAAAGGTGCAGG - Intronic
907222855 1:52920298-52920320 AACAGCAGGGAGCAAGGAACTGG + Intronic
907814896 1:57908739-57908761 AGCAGCAGCCAGACCGGAGCTGG - Intronic
909657153 1:78044993-78045015 ACTAGCAGTTAGCAAGGAGCAGG + Intronic
910115402 1:83726265-83726287 TTCAGCAGAAAGCAAGAAGCAGG + Intergenic
910254263 1:85231551-85231573 TGCAGCAGCATGGATGGAGCTGG - Intergenic
910427882 1:87133799-87133821 AGCAGCAGCTAAAAAGCAGCAGG + Intronic
911302413 1:96191700-96191722 AGGAGCAGCAAGAAGAGAGCAGG - Intergenic
912008598 1:104932946-104932968 AGGAGCAGGAGGGAAGGAGCAGG + Intergenic
912562126 1:110558463-110558485 AGCAGCAGCAAGTAAGGGGAAGG - Intergenic
913708646 1:121455622-121455644 AGTGGAAGCAAGGAAGGAGCAGG + Intergenic
915577325 1:156788295-156788317 TGCAGCAGCATGGATGGAGCTGG - Intronic
917248007 1:173025410-173025432 TGGAGCAACAAGCAAGAAGCAGG + Intergenic
917618210 1:176767981-176768003 AGGAGCAGCTAGCCAGGAGTTGG + Intronic
917972524 1:180217949-180217971 AGCAGGAGCATGGATGGAGCTGG - Intergenic
918748731 1:188242684-188242706 AGCACCAGCAGGGAAAGAGCAGG - Intergenic
918799380 1:188953263-188953285 GGCTGCAGCAGGCATGGAGCTGG + Intergenic
919933939 1:202239153-202239175 AGCAGAAGCAGGAAAAGAGCCGG - Intronic
920346281 1:205307674-205307696 AGCTGCAGAAAGCAGGAAGCTGG + Intronic
920404262 1:205697243-205697265 AGCAGGAGGAAGTCAGGAGCTGG + Intergenic
920657319 1:207886684-207886706 ATCAACAGCAAACAAGGACCTGG + Exonic
920824952 1:209416351-209416373 AGCAGGAGCAAAGCAGGAGCTGG + Intergenic
921048447 1:211493616-211493638 AGGGGCACCAAGCTAGGAGCTGG + Intergenic
921091611 1:211848811-211848833 AGCAGGAGCAGGCAAGGTGGGGG - Intergenic
921370750 1:214420562-214420584 AAGAGCAGAAAGCAAGGATCAGG - Intronic
921458583 1:215401900-215401922 AGCAGCAACATGCATGCAGCTGG - Intergenic
922230835 1:223684204-223684226 AGCAGCAGGTAACAAGGACCAGG + Intergenic
922810632 1:228413756-228413778 AGCAGCAGCAGGAAAGGGACTGG + Intronic
924540628 1:244977615-244977637 AGAAGGAGCAAGAAAGGAGAAGG - Intronic
924581344 1:245326638-245326660 AGCAGCAGCTGGTAAGGACCAGG + Intronic
924886510 1:248223439-248223461 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1062894006 10:1089229-1089251 AGAGGCAGCCAGGAAGGAGCGGG - Intronic
1063072026 10:2676241-2676263 AATAGCAGCAGGCAAGGATCGGG - Intergenic
1063237639 10:4135004-4135026 GGCACCAGCAAGCAAGAGGCTGG + Intergenic
1064860221 10:19817543-19817565 ACCAGCAGCGAGGAAGGAGGAGG - Intronic
1065244985 10:23747823-23747845 AGCAGCAGGAAACATGGAGATGG - Intronic
1065431027 10:25655718-25655740 AGCAGGAGCAAGAAGGGAGGAGG + Intergenic
1065870873 10:29955534-29955556 GGCAACAGCCAGCAGGGAGCTGG + Intergenic
1065976374 10:30846363-30846385 AGCAACAGCAGGCAAGGTGCAGG - Intronic
1066077173 10:31890650-31890672 ATCAGCAGCAAGCTAGGATTTGG + Intronic
1066254141 10:33662298-33662320 AGCAGCAGCAAGCATGGCAATGG - Intergenic
1066504648 10:36028735-36028757 AGGAGCAGCAAGTCAGGACCTGG + Intergenic
1066538413 10:36417080-36417102 TGCAGCAGCATGCATGGAGCTGG + Intergenic
1066645467 10:37603265-37603287 AGCAGCAGCATGCATGGAGCTGG + Intergenic
1066696095 10:38078804-38078826 AGCAGGAGCAAGGTAGGAGGAGG + Intergenic
1067368657 10:45661343-45661365 GGCTGCAGCAAGGGAGGAGCAGG - Intronic
1068838692 10:61586121-61586143 TGCAGCAGCATGAATGGAGCTGG + Intergenic
1069846180 10:71373391-71373413 AGCAGCAGAAAGCAAGGAAAGGG - Intergenic
1069876739 10:71567752-71567774 AGCAGCTGGGAGCAAGGAGAGGG - Intronic
1070821120 10:79355164-79355186 AGCAGGAGCAAGAAGGGGGCAGG - Exonic
1071724007 10:88177995-88178017 AGCAGCAGCAAGCCATGGGTGGG + Intergenic
1071876735 10:89850923-89850945 AGCAGCAGACAGCATGGAGCAGG + Intergenic
1071996971 10:91159018-91159040 AGAAGCAGGAAGCAGGAAGCAGG + Intergenic
1072258169 10:93640957-93640979 AGCAGCAGCAAGCATGGCAAAGG - Exonic
1072452052 10:95546446-95546468 AGGAGGAGCAGGCATGGAGCAGG + Intronic
1072860172 10:98995098-98995120 ACCAGAAGCAAGTAAGGAGAGGG - Intronic
1073669505 10:105571954-105571976 TGCAGCAACAAGGATGGAGCTGG + Intergenic
1074298086 10:112209583-112209605 AGCAGCAGCAGGCAGGAGGCTGG - Intronic
1074817577 10:117154309-117154331 GGTAGCAGCAGGCAAGGAACAGG + Intergenic
1075164196 10:120052294-120052316 AGCATCAGCATGGCAGGAGCAGG - Intergenic
1075279772 10:121129569-121129591 AGCAGCATCCACCCAGGAGCTGG - Intergenic
1076840975 10:133044989-133045011 AGCAGGAGCAGACCAGGAGCTGG - Intergenic
1077673576 11:4179207-4179229 AGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1077673583 11:4179255-4179277 GGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1077673590 11:4179303-4179325 GGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1077673597 11:4179351-4179373 GGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1078483522 11:11701162-11701184 ATCCTCAGCAAGGAAGGAGCAGG - Intergenic
1078505038 11:11932160-11932182 AGCAGGAGCAAGCAAGTTCCGGG + Intronic
1078519590 11:12052469-12052491 AGCTGGAGAAAGCAAGGAACTGG + Intergenic
1078718130 11:13858979-13859001 AGCAGAAGCAAGGAAGGGGGTGG + Intergenic
1079311068 11:19366396-19366418 AGAAGAAGCAAGCAGGAAGCAGG - Intronic
1079766677 11:24402558-24402580 TGCAGCAGCATGAATGGAGCTGG - Intergenic
1080791409 11:35525576-35525598 AGCCGCGGCAAGGATGGAGCTGG - Exonic
1080868421 11:36215207-36215229 AGCAGCAGCCAGGGAGGAGCAGG + Intronic
1081804739 11:45884400-45884422 TGCGGCACCTAGCAAGGAGCTGG - Intergenic
1083271065 11:61572873-61572895 TGCAGCAGGAAGCAGGGAGGTGG - Intronic
1083946801 11:65928126-65928148 AGCCGCAGCAAGCAAGTGGGTGG + Intergenic
1084548596 11:69827095-69827117 AACAGCAGCAAGCACTGATCTGG - Intergenic
1084563112 11:69915049-69915071 CCCAGCAGGCAGCAAGGAGCAGG - Intergenic
1084771039 11:71343215-71343237 AGCAGAAGCAGGCAGGGAGTGGG + Intergenic
1085249745 11:75135183-75135205 ATCAGCAGCAATACAGGAGCTGG - Intronic
1085381065 11:76119249-76119271 AGAAGCAGAAAGCCAGGAGAGGG - Intronic
1085566108 11:77515012-77515034 AGCAGCAACAGGCAAAGAGGAGG + Intronic
1085566969 11:77522916-77522938 TGCAGCAGCACACATGGAGCTGG + Intronic
1085960675 11:81457953-81457975 GGCAGCAGCAAGAAGGCAGCAGG - Intergenic
1086096884 11:83059579-83059601 AGTAGCAGGAACCAAGTAGCAGG + Intronic
1086139581 11:83480602-83480624 AGAAACAGCAATCAAGCAGCGGG - Intronic
1086304155 11:85461686-85461708 TGCAGCAGCAAAAAAGGAGACGG + Intronic
1086532572 11:87803189-87803211 ACCAGCAGCTAGGAAGAAGCAGG - Intergenic
1088667421 11:112107618-112107640 ACCAGTAGCAAGGAAGGAGAAGG + Intronic
1089076810 11:115745152-115745174 AGCAGCTGCAGGGGAGGAGCAGG - Intergenic
1089181972 11:116589572-116589594 AGCAGCAACAGGTAAGGAGCTGG + Intergenic
1089298386 11:117483125-117483147 AGCAGCAGGAGGCAAGGGGCAGG + Intronic
1089758208 11:120702609-120702631 AGAAGCAGCAACCAAGGGGCAGG + Intronic
1089846433 11:121462304-121462326 AGCAGAAGCCAGGAAGGAGAAGG - Intronic
1089923842 11:122236594-122236616 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1090716858 11:129438769-129438791 AGACGCAGCAAGCCAGGCGCTGG + Intronic
1090833964 11:130440343-130440365 AGCAGCAGAAAGCATGGCGTGGG + Intergenic
1091259435 11:134223287-134223309 AGCAGCATCAGGAATGGAGCGGG + Intronic
1091788378 12:3256762-3256784 AGCAGGAGCCATCATGGAGCTGG + Intronic
1091798028 12:3308428-3308450 GGCAGCAGCAACCAAGGCTCAGG + Intergenic
1092847843 12:12600577-12600599 TGCAGCAGCAAGAACAGAGCAGG + Intergenic
1092911392 12:13148098-13148120 AAAAGCAGTAAGCAGGGAGCTGG - Intergenic
1093000637 12:13992289-13992311 AGCAGCTGTAAGCAAGGAGAGGG + Intergenic
1095131181 12:38544494-38544516 AACAGCAGCATGCAATGGGCTGG - Intergenic
1095786050 12:46109931-46109953 AGCAGCAGCTAGCTAGGTTCCGG - Intergenic
1096571873 12:52528052-52528074 GGCAGCCTCATGCAAGGAGCTGG - Intergenic
1096648061 12:53048840-53048862 AGGAGCAGGAAGCAAGTAGAAGG + Intronic
1096757998 12:53816154-53816176 AGCAGCAGAAAACAAGGCCCAGG - Intergenic
1097070914 12:56354327-56354349 AGCTGCAGTCAGCAGGGAGCAGG + Intronic
1097193899 12:57233401-57233423 AGCATCAGTTAGCAAGGTGCAGG - Intronic
1097885154 12:64721545-64721567 AGCACCAGCAAGAAAGGAGCGGG + Intronic
1097985215 12:65775818-65775840 AGTAGCAGAGAGCAACGAGCTGG - Intergenic
1098385243 12:69911612-69911634 AGCATCGACAAGCAAGGAACTGG - Intronic
1098435516 12:70464541-70464563 AGCTGCAAAAAGCAAGGAGATGG - Intergenic
1098614796 12:72508889-72508911 AGCAGAAGGAAGAAAAGAGCAGG - Intronic
1098861411 12:75714988-75715010 AGGAGCACCAAGGAAGGAGGGGG - Intergenic
1098904805 12:76150976-76150998 AGCAGCAGCAAGGAAGGAGTGGG + Intergenic
1099647178 12:85372793-85372815 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1100024145 12:90107224-90107246 TGCAGCAACATGCATGGAGCTGG + Intergenic
1100237243 12:92673053-92673075 AGCGGCTGCAAGCAAGAAGGTGG + Intergenic
1100249930 12:92809111-92809133 AGTTAAAGCAAGCAAGGAGCAGG - Exonic
1100861926 12:98815543-98815565 AGAAGCATCAAGCAGGCAGCTGG - Intronic
1102196650 12:111030231-111030253 AGCAGAAGCAGGCAGAGAGCCGG - Intergenic
1102903636 12:116658383-116658405 ACCAGCAGAAAGCAACAAGCAGG - Intergenic
1103631555 12:122265890-122265912 AGCAGCAGGTTGCAAGGTGCAGG + Intronic
1103744766 12:123115023-123115045 TGGAGCAGCATGCAGGGAGCTGG - Intronic
1105014182 12:132776184-132776206 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014213 12:132776343-132776365 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014230 12:132776420-132776442 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014247 12:132776499-132776521 AGCAGCAGGGAGGAAGGAACTGG - Intronic
1105014264 12:132776578-132776600 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105037103 12:132933523-132933545 GGCTGCAGCGAGGAAGGAGCTGG - Intronic
1105443629 13:20435024-20435046 AGCAGCAGAAAGCTAGGTTCAGG + Intronic
1105925761 13:25006383-25006405 TTCAGCAGCATGCATGGAGCGGG + Intergenic
1105984887 13:25555918-25555940 TGCAGCAACATGCATGGAGCTGG - Intronic
1106766995 13:32923154-32923176 ATCAGCACCAAGAAAGCAGCTGG + Intergenic
1107432885 13:40355645-40355667 GTCAGCAGGAAGCAAGGAACAGG + Intergenic
1108392071 13:49956298-49956320 AGCAGCAGCAAGAAAGGAGGAGG - Intergenic
1108467312 13:50729327-50729349 TGCAGCAACATGCATGGAGCTGG - Intronic
1109887384 13:68559523-68559545 ACCAGCAACAAGCAAGGAAGAGG - Intergenic
1109910855 13:68908182-68908204 AGCAGGAGCAAGGAAAGAGGAGG - Intergenic
1110037937 13:70712538-70712560 GCCAACAGCCAGCAAGGAGCTGG - Intergenic
1111393782 13:87635623-87635645 TGCAGCAACATGCATGGAGCTGG + Intergenic
1111808809 13:93071909-93071931 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1111976111 13:94968342-94968364 AGCAGAGGGAAGCTAGGAGCGGG + Intergenic
1112579720 13:100668136-100668158 TTCAGCAGCAGGCAGGGAGCTGG - Intronic
1112786547 13:102957671-102957693 ACCAGCAGCCAGCAAGGAATGGG + Intergenic
1113006859 13:105715090-105715112 CGCAGCAACATGGAAGGAGCTGG - Intergenic
1113015981 13:105828673-105828695 AGCAGGAACAAGCAAGGGGATGG - Intergenic
1113630763 13:111882055-111882077 AGCAGCAGCAAAGAAGCAGGAGG + Intergenic
1114132028 14:19802162-19802184 TGCAGCAACATGCATGGAGCTGG - Intronic
1114484504 14:23054893-23054915 AGCAGCAGCAGGGAAGGATGGGG + Intronic
1114497952 14:23146903-23146925 AGCAGTAGCTAGCCAGCAGCAGG - Intronic
1114553756 14:23549832-23549854 AGTACCAGCAAGCAAAGGGCTGG - Intronic
1114688911 14:24562229-24562251 AGCAGGAGCAAGGCAGGAGGGGG - Intergenic
1114705628 14:24723913-24723935 TGCAGCAGCACGGATGGAGCTGG + Intergenic
1114711124 14:24779278-24779300 AGGAGATGCAAACAAGGAGCTGG - Intergenic
1114773753 14:25458055-25458077 AGCAGGAGCAGGAAAAGAGCCGG + Intergenic
1115008626 14:28517364-28517386 TGCAGCAACAAGGATGGAGCTGG - Intergenic
1115311829 14:31986217-31986239 AGCACCAGCAACCAAGAAGTGGG - Intergenic
1115497750 14:34023765-34023787 AGCAGCAGCAAGCACCTATCTGG + Intronic
1116359881 14:43980497-43980519 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1116375181 14:44190447-44190469 AAAAGAAGCAAGCGAGGAGCAGG + Intergenic
1117443075 14:55778070-55778092 AGCAGGAGCAATAAAGCAGCTGG - Intergenic
1117533253 14:56679417-56679439 TGCAGCAGCATGGATGGAGCTGG + Intronic
1118049573 14:62012322-62012344 ACCAACAGCCAGCAAGAAGCTGG - Intronic
1119387647 14:74267744-74267766 AGCAGCAGCCAGGAGGGAGGTGG - Intergenic
1119414246 14:74459077-74459099 AGCAGCAGCATGCACCCAGCAGG + Intergenic
1120237502 14:81909472-81909494 AGCAGCAGCAAGATAGGAGGTGG + Intergenic
1120511376 14:85419882-85419904 AGCAGGAGAAAGCAAGGAAAGGG - Intergenic
1120673196 14:87387970-87387992 AGCAGAAGCAGGAAAAGAGCTGG - Intergenic
1121714388 14:96062611-96062633 AGCAGCCGTGAGCAGGGAGCTGG - Intronic
1121911596 14:97797006-97797028 AGCAGAAGGAAGCCAGGAGAGGG - Intergenic
1121935781 14:98017244-98017266 AGCATCAGCATGCGAGGCGCAGG - Intergenic
1122403198 14:101479664-101479686 TGCAGCAGCACGGATGGAGCTGG + Intergenic
1122479096 14:102034389-102034411 GTCATCAGCAGGCAAGGAGCTGG - Exonic
1122770594 14:104095960-104095982 AGCAGCCGCAAGGAAGCATCGGG - Intronic
1122811207 14:104290238-104290260 AGCAGCAGGAAGCAGGAGGCAGG - Intergenic
1123041864 14:105493556-105493578 AGCAGCAGCAAGATTGGAGTGGG - Intronic
1123575109 15:21657879-21657901 TGCAGCAACATGCATGGAGCTGG - Intergenic
1123611725 15:22100368-22100390 TGCAGCAACATGCATGGAGCTGG - Intergenic
1123689309 15:22823664-22823686 AGCAGCCGCAACCCAGGAGGTGG - Intronic
1123838430 15:24221590-24221612 AGCATCTCCAAGTAAGGAGCTGG - Intergenic
1123847971 15:24323874-24323896 AGCATCTCCAAGTAAGGAGCTGG - Intergenic
1123867018 15:24531239-24531261 AGCATCTCCAAGTAAGGAGCTGG - Intergenic
1123967985 15:25477973-25477995 GGCAGCAGACAGCAAGGAACAGG - Intergenic
1124254670 15:28130987-28131009 AGGAGCAGCAGGCAAGGGGAGGG + Intronic
1124616561 15:31246368-31246390 AGCAGCACCCAGCAATGAGGGGG - Intergenic
1126173010 15:45709690-45709712 AGCAGCAGGCAGCAGGCAGCAGG + Intergenic
1126779263 15:52124671-52124693 AGAAACAGGAAGCAAGGAACTGG - Intronic
1127979616 15:64024939-64024961 AGAAGCTGCCAGCAAGGAGGTGG + Intronic
1128342414 15:66831733-66831755 AGCAGAAGCAAGCAGGCATCAGG + Intergenic
1129296357 15:74602384-74602406 AGCAGCAGCTGAAAAGGAGCTGG - Intronic
1129694636 15:77733634-77733656 AGCAACAGCAAGCCATGAGAGGG - Intronic
1129720463 15:77875216-77875238 AGCAGCAGCAAAGCAAGAGCGGG + Intergenic
1130902837 15:88219955-88219977 AGCAGAAGCAAGAGAGGAGGGGG - Intronic
1131179862 15:90232387-90232409 ATGAGCAGCAGGCAAGGAGTGGG - Intronic
1132126214 15:99227541-99227563 AGCAGAAGCATGCCATGAGCAGG - Intronic
1132135866 15:99337970-99337992 AACAGCAGGAAGAAAGGATCAGG + Intronic
1202983977 15_KI270727v1_random:392123-392145 TGCAGCAACATGCATGGAGCTGG - Intergenic
1132520176 16:383613-383635 AGTAGCTGCAAGAAAGGAACAGG + Intronic
1132828202 16:1915237-1915259 AGCAAGAGGAGGCAAGGAGCGGG - Intronic
1132837418 16:1961162-1961184 AGCGGCAGCACGCAAAGAACAGG + Exonic
1133885845 16:9826967-9826989 AGCAGCAGGAAGCAATGTCCTGG - Intronic
1134140096 16:11710976-11710998 AGCAGCTCCAAGAAAGAAGCTGG + Intronic
1134188933 16:12106458-12106480 AGCAGCAGCAGAAAAGGAGGGGG - Intronic
1134625559 16:15720237-15720259 AGCTGCAGCAAAGAAGAAGCTGG - Exonic
1135743650 16:24997950-24997972 ACCAGCAGCAAACACGGATCTGG + Intronic
1136318027 16:29465581-29465603 AGCAGCTGCGAGGAAGGGGCTGG - Intronic
1136432602 16:30204930-30204952 AGCAGCTGCGAGGAAGGGGCTGG - Intronic
1136556576 16:31010708-31010730 AGCGGGAGCGCGCAAGGAGCAGG + Intergenic
1137278751 16:46957051-46957073 AGCAGCAGCCATCATGGACCTGG - Exonic
1137378580 16:47976498-47976520 AGCAGCATCATGCAAGGAAGAGG - Intergenic
1137506983 16:49062742-49062764 TACAGCAGCAAGGAGGGAGCAGG + Intergenic
1138036493 16:53612264-53612286 AAGAGCAGTAAGCTAGGAGCTGG - Intronic
1138319512 16:56099892-56099914 AGCAGCAGTAAGCAAAGGTCTGG + Intergenic
1139053471 16:63153567-63153589 AGCAGCAACATGGAAGGAGCTGG + Intergenic
1139255131 16:65533824-65533846 AGCAGCAGCATGGATGAAGCTGG - Intergenic
1140113981 16:72026018-72026040 AGAAGCAGAAGGCAATGAGCCGG - Intronic
1140542028 16:75764966-75764988 TGCAGCAACAAGGATGGAGCTGG - Intergenic
1140550566 16:75861394-75861416 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1140649126 16:77067318-77067340 AGAGGAAGCCAGCAAGGAGCAGG + Intergenic
1140864720 16:79050083-79050105 AGCAGCAGCAACCAAGTCACTGG - Intronic
1141136652 16:81469953-81469975 AGCAGCAGCAGGTAAAGAGCAGG + Intronic
1141500891 16:84443381-84443403 CACAGCAGAAAGCACGGAGCGGG - Intronic
1141556813 16:84841937-84841959 CGCAGCAGGAAGCAGGGAGGCGG + Intronic
1141698978 16:85633809-85633831 AGCAGCAGCAGGCAGGGAGCAGG - Intronic
1142139666 16:88467248-88467270 AGCCGCAGCAAACAAGCAGGGGG + Intronic
1142250479 16:88989623-88989645 GGCAGCAGCCAGCGAGGGGCCGG - Intergenic
1142613951 17:1124351-1124373 AGCAGGACCAAGCAAGGATGGGG + Intronic
1142811775 17:2398979-2399001 AGCGGCAGCGGGCAAGGGGCGGG - Intronic
1143041791 17:4043576-4043598 AGCAGCAGCAAGGTCAGAGCTGG - Intronic
1143170066 17:4923881-4923903 TGCAGCAGCATGAATGGAGCTGG - Intergenic
1143394914 17:6586126-6586148 AGAAGGAGCAAGCAAGGGGTGGG - Intronic
1143436744 17:6934311-6934333 TGCAGCAACATGGAAGGAGCTGG - Intronic
1143563319 17:7707751-7707773 AGCAGCAGGAAGCCAGGCTCAGG - Intronic
1144628986 17:16860647-16860669 ACCTGCAAAAAGCAAGGAGCAGG - Intergenic
1145160558 17:20571213-20571235 ACCTGCAAAAAGCAAGGAGCAGG - Intergenic
1146138213 17:30341649-30341671 AGCAGATGCATGGAAGGAGCTGG + Intergenic
1146306079 17:31730809-31730831 AGCAGCAGCAAGAAAGAAGGGGG + Intergenic
1146637989 17:34520133-34520155 TACAGCAGCAAGCCAGGGGCTGG + Intergenic
1147169647 17:38610494-38610516 AGCAGCACCGAGCATGGACCTGG - Intergenic
1147783983 17:42964816-42964838 AGAAATAGAAAGCAAGGAGCTGG + Intronic
1148027795 17:44600394-44600416 ATCAGCAGCAAGGAGGGAGGTGG - Intergenic
1148053971 17:44782537-44782559 AGCAGCACCAAGCAGGGGCCTGG + Intergenic
1148104345 17:45111461-45111483 AGCAGCTTTAAGCCAGGAGCAGG + Exonic
1149374961 17:56034562-56034584 AGCAGCAGCTAGGAAGAACCAGG + Intergenic
1149594134 17:57853843-57853865 AGAAGCAGAGGGCAAGGAGCTGG - Intergenic
1150065945 17:62109499-62109521 AGGAGGACCAATCAAGGAGCAGG - Intergenic
1150816546 17:68396503-68396525 AGCAGGAGGAGGCAAGGAGGCGG + Intronic
1151158381 17:72143554-72143576 AGGACCAGAAAGCAAGGAGCTGG + Intergenic
1151192619 17:72409429-72409451 AGCCTCAGCAAGAAAAGAGCAGG + Intergenic
1151673299 17:75584917-75584939 AGCAGCACCCAGCACAGAGCAGG - Intergenic
1151881413 17:76897430-76897452 AGGAGCAGCCAGGAAGGGGCAGG - Intronic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152768905 17:82155731-82155753 AGCAGCAAGCAGCAAGGACCTGG + Intronic
1152865942 17:82723081-82723103 AGGACCAGCAAGTTAGGAGCTGG + Intronic
1154378520 18:13828669-13828691 AGCAGCTTCAGGCATGGAGCAGG + Intergenic
1155105898 18:22666085-22666107 TGCAGCAACATGAAAGGAGCTGG + Intergenic
1155801166 18:30105308-30105330 TGCAGCAGCATGGATGGAGCTGG - Intergenic
1156182015 18:34615883-34615905 AGCAGCAACATGGATGGAGCTGG - Intronic
1157574954 18:48737307-48737329 AGCAGCACCAGGGCAGGAGCTGG - Intronic
1157717080 18:49895183-49895205 AACATCAGCAAACAAGGAGAAGG + Intronic
1157918966 18:51696725-51696747 AGCAGAAGCAAGAAGAGAGCCGG + Intergenic
1158454366 18:57593446-57593468 AGCAGCGGGAGGCAAGGGGCAGG + Intergenic
1158616561 18:58992967-58992989 AGCAGCAGCAATCAACCGGCTGG - Intergenic
1159351105 18:67273904-67273926 TGCAGCAACATGGAAGGAGCTGG + Intergenic
1159553164 18:69918025-69918047 AGCCACACCAAGCAAGGAGAAGG + Intronic
1159952639 18:74496375-74496397 ACCAGCAGCAAGCGCGGCGCCGG - Exonic
1159959098 18:74541642-74541664 GGCAGCAGCAAGGCTGGAGCAGG + Intronic
1160364023 18:78309055-78309077 AACAGAAGCAAGCAAAGAGGGGG + Intergenic
1160550883 18:79693136-79693158 GGCCTCAGCAAGCAGGGAGCAGG + Intronic
1160672944 19:374898-374920 AGCTGCATCAAGCAAGGACAGGG - Intronic
1162130938 19:8525900-8525922 GGCAACAGCAAGGAAGGGGCGGG - Intronic
1163049234 19:14669257-14669279 AGCAGCAACATGGATGGAGCTGG + Intronic
1163420229 19:17210076-17210098 ACCACCAGCAAGCAGGAAGCTGG - Intronic
1164147723 19:22522431-22522453 AGCAGCAAACAGCAAAGAGCTGG - Intronic
1164496351 19:28767235-28767257 TGCAGGAGCAAGGATGGAGCTGG - Intergenic
1164535002 19:29078944-29078966 TACAGCAGCCAACAAGGAGCAGG + Intergenic
1164880599 19:31729520-31729542 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1165266733 19:34667447-34667469 GGCAGCAGCAGGGCAGGAGCTGG - Intronic
1165330369 19:35138622-35138644 AGCAGCAGCAGGCAGCCAGCAGG - Intronic
1165665885 19:37627611-37627633 TGCAGCAACAAGGATGGAGCTGG - Intronic
1166634454 19:44437813-44437835 TGCAGCAACATGGAAGGAGCTGG + Intronic
1167270615 19:48503674-48503696 AGCAGGAGGAATCAAAGAGCCGG - Intronic
1167671306 19:50855241-50855263 AGCAGCTGGGAGCAGGGAGCTGG - Intronic
1168552850 19:57312439-57312461 TGCAGCAGCATGGATGGAGCTGG - Intergenic
925868327 2:8247995-8248017 AGCAGGAGCAGGCCAGGGGCTGG + Intergenic
926669308 2:15561146-15561168 AGCAGCAGCCAGCTTGGCGCGGG - Intronic
927062988 2:19441693-19441715 GGGAGCAGCAAGAAAGAAGCTGG - Intergenic
927301349 2:21519571-21519593 GGCAGCAGCAAGCCAGGGGGAGG + Intergenic
927694121 2:25229035-25229057 GGGAGAAACAAGCAAGGAGCAGG - Exonic
928278822 2:29926079-29926101 AGCAGCAGCAAGCAGGAGGGAGG + Intergenic
928662610 2:33518858-33518880 AGCAGTAACAGGCATGGAGCTGG + Intronic
928805920 2:35154783-35154805 TGCAGCAGCATGGATGGAGCTGG + Intergenic
929207816 2:39318091-39318113 TGCAGCAACAAGGATGGAGCTGG + Intronic
929885580 2:45874773-45874795 GCCAGCAGCAAGCAGGAAGCAGG - Intronic
930202771 2:48560725-48560747 AGCTGCAGAAACCCAGGAGCTGG + Intronic
930728802 2:54708895-54708917 AGCAGCGGTAGGCAAGGTGCAGG - Intergenic
930989661 2:57637377-57637399 AGAAGTAGGAAGCATGGAGCTGG + Intergenic
931800646 2:65754959-65754981 AGAAGCAGCAAGCAAGGCCCTGG - Intergenic
931929852 2:67119540-67119562 TGCCGCAGCATGGAAGGAGCTGG + Intergenic
932266100 2:70368109-70368131 TGCAGGAGCAATCACGGAGCTGG + Intergenic
932661764 2:73660675-73660697 TGCAGCAGCATGGATGGAGCTGG - Intergenic
932909093 2:75786986-75787008 AGCAGCATCAGGCCTGGAGCTGG + Intergenic
933785647 2:85839075-85839097 AGCAGCAGCATCCAAGAAGGAGG + Intergenic
933835499 2:86242237-86242259 TGCAGCAGTAAGCAGGGAGCTGG + Intronic
933865147 2:86509347-86509369 AGTAGCAGTAAGGAAGGAACTGG - Intronic
933970089 2:87463196-87463218 AGCAGCAGCTAGCAGCAAGCAGG - Intergenic
934067581 2:88353929-88353951 AGAAGCAGCACACAAGGGGCCGG + Intergenic
935975802 2:108577312-108577334 AGCAGCAGCAAGAAAGGCCTAGG - Intronic
936259313 2:110944641-110944663 TGCAGCAACAAGGATGGAGCTGG - Intronic
936323693 2:111487300-111487322 AGCAGCAGCTAGCAGCAAGCAGG + Intergenic
936600465 2:113890117-113890139 AGCAGTAGCAAGAAAGCAGCAGG - Exonic
936715613 2:115183844-115183866 AGGAAGAGCAAGCAAGGAGGAGG + Intronic
937221907 2:120346688-120346710 AGCCGGAGCTAGCAAGGAGAGGG - Intronic
937288270 2:120766577-120766599 AGCAGGAGGAAGCCAGGAGGTGG + Intronic
938737343 2:134198386-134198408 AGAATTACCAAGCAAGGAGCAGG + Intronic
939284787 2:140114979-140115001 AGGAGCAGCAGAAAAGGAGCTGG + Intergenic
939891056 2:147736813-147736835 AGCAGCAACATGGAAGGAACTGG + Intergenic
940461911 2:153975304-153975326 AGCACCAGTAAAAAAGGAGCAGG - Intronic
941127344 2:161600542-161600564 AGCGGCAGGAAGAAAGGAGAAGG - Intronic
941588087 2:167384647-167384669 AGCAGCAGTAAGGATGGAGCAGG - Intergenic
941997639 2:171615705-171615727 TGCAGCAGCATGGAAGGAACTGG + Intergenic
942896479 2:181061475-181061497 TACAGCAGCATGGAAGGAGCAGG - Intronic
943762301 2:191623136-191623158 AGCACCTGCAAGCAAGGGGATGG - Intergenic
943945153 2:194051662-194051684 TGCAGCAACATGGAAGGAGCTGG + Intergenic
944177666 2:196850865-196850887 AGCAGCAGCAAAAAAAGAACAGG + Intronic
944468439 2:200027398-200027420 AGCAGCAGCAGGCCAGGCACGGG + Intergenic
945492147 2:210468762-210468784 TGGAGCAGAAAGGAAGGAGCTGG + Intronic
945542655 2:211107661-211107683 ATCAGGAGCAAGAAAGTAGCGGG + Intergenic
947002428 2:225472321-225472343 GCCAGCAGCAAGTAAGAAGCAGG + Intronic
947464887 2:230334367-230334389 AGCAGCAGGAACCAGGGAACAGG - Intronic
947488700 2:230575532-230575554 AGAAGCTGCAAGAAAGAAGCAGG - Intergenic
947538865 2:230960783-230960805 AGCAGAAGCCACCCAGGAGCCGG + Intronic
947545024 2:231004415-231004437 AGCAGAGTCAAGAAAGGAGCCGG - Intronic
948719607 2:239890574-239890596 ACCAGGAGCAAGAGAGGAGCAGG - Intergenic
948754534 2:240151185-240151207 GGCAGCAGCTGGGAAGGAGCTGG - Intergenic
948791018 2:240376895-240376917 AGCAGCAGCTGGCAGGGAGGAGG - Intergenic
948807332 2:240458722-240458744 AGCAGCTGCAAGCAAAGAACTGG - Intronic
1168781452 20:494773-494795 AGCAGCAGCAAGGATAAAGCTGG - Intronic
1168938235 20:1686352-1686374 ATCAGCAGCAGGAAAGGACCAGG + Intergenic
1170314757 20:15030773-15030795 AGCAGCAGCAAAACTGGAGCTGG + Intronic
1170398329 20:15952441-15952463 AGCTGCAGGAAGCAAGAAGCTGG - Intronic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1170846335 20:19964995-19965017 TGCAGTAGAAAGCAATGAGCCGG - Exonic
1171048587 20:21834559-21834581 AGGAGCAGCAAGCAAGCACAGGG - Intergenic
1171114821 20:22516011-22516033 TGCAGCAGCATGAATGGAGCTGG + Intergenic
1171138570 20:22720680-22720702 TGCAGCAACAAGAATGGAGCTGG - Intergenic
1171247985 20:23628708-23628730 AGAAACAGAGAGCAAGGAGCAGG - Exonic
1171937784 20:31292463-31292485 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1172407138 20:34698291-34698313 AGGAGCAGAAAGAAAGGAACTGG - Intronic
1172438360 20:34946634-34946656 AACATCAACCAGCAAGGAGCAGG - Intronic
1172913707 20:38428718-38428740 AGCAGCGTCCAGCAAGCAGCTGG + Intergenic
1173021630 20:39272370-39272392 AGCAGAAGCAGGCAAGAACCTGG - Intergenic
1173235982 20:41245878-41245900 AGAAGCAGCAAGCAAGGAAAGGG + Intronic
1175178339 20:57127352-57127374 AGAAGCAGGCAGCAAAGAGCAGG - Intergenic
1175275125 20:57763153-57763175 ATCTGCAGCAAGCCTGGAGCTGG + Intergenic
1175496849 20:59420502-59420524 AGAAGAAGGAAGGAAGGAGCTGG - Intergenic
1175811750 20:61862090-61862112 AGCTGCAGGAGGAAAGGAGCTGG - Intronic
1175826812 20:61940995-61941017 AGTGGCAGCAAGGAAGGAGCTGG + Intergenic
1177178735 21:17722568-17722590 TGCAGCAGCAAGGATGGAACTGG + Intergenic
1178060275 21:28846092-28846114 TGCAGCAGCATGGATGGAGCTGG - Intergenic
1178331388 21:31696610-31696632 AGCAGCAGCAGGCACGGTGGCGG + Exonic
1178378825 21:32091656-32091678 AGCAGCAGCGCTCATGGAGCAGG - Intergenic
1178398142 21:32260619-32260641 AGCAGCAGCAAGGAGGCAGGAGG + Intergenic
1179533802 21:42038571-42038593 AAGAACAGCAAGCTAGGAGCTGG - Intergenic
1179711920 21:43268425-43268447 AGCAGCAGATAGGAAGGAGCAGG - Intergenic
1180033895 21:45232367-45232389 AGCAACAGCAAGCAAATGGCAGG - Intergenic
1181088557 22:20456672-20456694 AGAAGCTGAGAGCAAGGAGCAGG + Intronic
1181549274 22:23627704-23627726 AGCAGCAGGAGCCAAGGGGCAGG + Intronic
1181555753 22:23670882-23670904 AGCAGAGGCAGGGAAGGAGCAGG + Intergenic
1181561230 22:23702468-23702490 GGCAGCACCATGAAAGGAGCTGG + Intergenic
1181698617 22:24607759-24607781 AGCAGAGGCAGGGAAGGAGCAGG - Intronic
1181736102 22:24882803-24882825 CGCAGCAGCATGGATGGAGCTGG - Intronic
1182178467 22:28318464-28318486 AGCAGTAACAAGCAAGCAGTGGG - Intronic
1183373214 22:37447482-37447504 AGCAGCTGCAGCCATGGAGCTGG + Intergenic
1183720860 22:39560550-39560572 AGCAGCAGCAGGGGAAGAGCTGG - Intergenic
1184116622 22:42426292-42426314 ACCAGCAGCAAGCAAAGATCTGG + Intronic
1184318806 22:43722899-43722921 TGCAGCAACATGCATGGAGCTGG + Intronic
1185311507 22:50158252-50158274 AGCTGCAGGAGCCAAGGAGCAGG - Intronic
949905131 3:8852718-8852740 AGCAGCAGCAACCAAGGCTGAGG + Intronic
950053286 3:10007932-10007954 AGGACCAGGAAGCAAGAAGCAGG + Intronic
950128976 3:10528842-10528864 ACCAGCACCAAGCAAGTAGCCGG - Intronic
950304928 3:11910217-11910239 AGGACCAGGAAGCAAGAAGCAGG + Intergenic
951142499 3:19181353-19181375 AGTAGCAGAAAGAAAGGAGGAGG + Intronic
953862341 3:46555787-46555809 AACAGCAGGAAGGAAGGAACAGG - Intronic
954574284 3:51666926-51666948 AGGAGCAGGAAGCAAAGTGCTGG + Exonic
954683869 3:52360111-52360133 AGCAGCTGCCAGGAAGGGGCAGG + Intronic
954866699 3:53735766-53735788 AGCAGCAGGGAGCAAAGAGGCGG - Intronic
955386664 3:58486266-58486288 AGCAGGAGCCAGCAGGGGGCTGG + Intergenic
956700589 3:71955564-71955586 AGAAGCACCAAGCAAGGGGAAGG + Intergenic
957261364 3:77906216-77906238 GGCAGAAGCAATCTAGGAGCTGG + Intergenic
958045602 3:88280384-88280406 AAGAGCAGCAAGGAAGCAGCAGG + Intergenic
958056530 3:88419401-88419423 TGCAGCAGCATGAATGGAGCTGG - Intergenic
958152561 3:89709518-89709540 TGCAGCAGCATGGATGGAGCTGG + Intergenic
958874752 3:99603432-99603454 TGCAGCAACAAGGATGGAGCTGG - Intergenic
959642927 3:108661685-108661707 AGCAGCAACAGGCAAGTAACTGG + Intronic
959673398 3:109005675-109005697 AGTAGCAGCTAGCAAGGGGCAGG - Intronic
960011241 3:112835970-112835992 AGCCGCAGTAGGCAAAGAGCAGG + Intronic
960838064 3:121927453-121927475 AGCAGAAGCAAGCGAGGAGATGG - Intronic
960966719 3:123110751-123110773 AGCCGCGGCAGGCCAGGAGCTGG - Intronic
961184144 3:124899883-124899905 AGCAGCAGCAGGCATGTTGCAGG + Intronic
961366005 3:126399842-126399864 TGCAGCAGGCAGCAAGGAGAAGG + Intronic
961943096 3:130657127-130657149 CGCAGCTGCATTCAAGGAGCAGG + Intronic
962657686 3:137565400-137565422 AGCAGGAGCAAGAAAGAGGCAGG - Intergenic
963444597 3:145388068-145388090 AGCAGTTGCAAGCAAGCTGCAGG + Intergenic
964072591 3:152652951-152652973 AGGAGCAGCAAGGAAGGTGAAGG + Intergenic
964557417 3:157954746-157954768 AGCAGCACCAAGCATGGAGGTGG - Intergenic
966923753 3:184631135-184631157 AGGAGCAGCCAGCATGGAGCCGG + Intronic
967111127 3:186294920-186294942 AGCACCAGAAAGCAAGGATGAGG - Intronic
967297308 3:187977974-187977996 TGCAGCTGCCAGCAAGGAGGTGG - Intergenic
972967627 4:44530929-44530951 TGCAGCAACATGCATGGAGCTGG - Intergenic
973126292 4:46589545-46589567 TGCAGCAGCATGGATGGAGCTGG - Intergenic
973267520 4:48225922-48225944 AGCAGCAGCCAGAAAGGAGGTGG + Intronic
973708598 4:53603641-53603663 AGCAGGAGCAAGAGAGGCGCGGG + Intronic
974595421 4:64008612-64008634 AGCACCAGCAAGAAAGAAGTGGG - Intergenic
974619788 4:64340532-64340554 AGCAGCAGGCAGCAGGGGGCTGG - Intronic
975362322 4:73485528-73485550 AGAAGCAGAAAACAAGGAGAAGG + Intronic
976326158 4:83774093-83774115 AGCAGAAGGATGGAAGGAGCTGG - Intergenic
978479679 4:109174866-109174888 CGCAGCAGGAAGCAAGCAGCAGG + Intronic
981444803 4:144823285-144823307 TGCAGCAGCATGGATGGAGCTGG - Intergenic
983593999 4:169445517-169445539 AGCAGCAACATGGATGGAGCTGG + Intronic
983830405 4:172320067-172320089 AGTAACAGGAAACAAGGAGCAGG - Intronic
983913315 4:173264777-173264799 AGAACCAGCCAGCAAGCAGCTGG + Intronic
985133880 4:186766184-186766206 AGCAGCAGCAGTGAAAGAGCAGG + Intergenic
986009662 5:3700770-3700792 AGAAGAAGAAAGCAAGGAGGAGG - Intergenic
986041107 5:3994968-3994990 ACCAGCTGCAGGCAAGGATCAGG + Intergenic
986290686 5:6396832-6396854 ATCAGCAGCAGGCAAGCAGGTGG + Intergenic
987141098 5:14947291-14947313 AGGAGAAGCAAGAAAGGAACAGG - Intergenic
987182332 5:15380846-15380868 AGCAGGAGCAAGGAAGGGGGGGG - Intergenic
987380152 5:17277447-17277469 TGCGGAAGCAAGCATGGAGCCGG + Intergenic
987856095 5:23422743-23422765 AGCAGCTGCAAGTAAGTAGGTGG + Intergenic
988698662 5:33650024-33650046 AGCAGGAGAAAGCAAATAGCTGG - Intronic
989292048 5:39779306-39779328 AGCAGGAGCAAGAAAGAAGAGGG - Intergenic
989299283 5:39869821-39869843 TGCAGCAGCATGGATGGAGCTGG - Intergenic
989339949 5:40362940-40362962 TGCAGCAGCATGGATGGAGCTGG - Intergenic
989475715 5:41870500-41870522 AGCAGCAGCCAGCAGCGCGCCGG - Exonic
989969449 5:50504927-50504949 AGTGGAAGCAAGGAAGGAGCAGG - Intergenic
990640333 5:57776447-57776469 AGCAGGAGGAAACAAGGATCTGG - Intergenic
990937179 5:61162916-61162938 AGCAGCGGCAAGAAAGCAGTTGG + Intergenic
991646386 5:68804409-68804431 ATCAGCATCAAGCAAGTAGAAGG + Intergenic
992166161 5:74054059-74054081 ACACCCAGCAAGCAAGGAGCTGG - Intergenic
992206489 5:74435159-74435181 AAATGCAGCAAGGAAGGAGCTGG + Intergenic
992552602 5:77873442-77873464 AGAAGAAGGAAGGAAGGAGCAGG - Intergenic
993045226 5:82858738-82858760 AGCAGGAACAAAAAAGGAGCTGG + Intergenic
993946727 5:94124136-94124158 AGCAGCAGCAAGCAAGGGGAGGG + Intergenic
994603960 5:101943174-101943196 AGCTGCAGCAAGCACAAAGCTGG - Intergenic
994843844 5:104959595-104959617 AGCAACAGCAAGAAAGAGGCAGG + Intergenic
995725764 5:115179415-115179437 AGCAGCAGCAGCTAAGGACCTGG + Intronic
996514389 5:124353766-124353788 AGCAGGAGCAAGTCTGGAGCAGG + Intergenic
996800421 5:127396820-127396842 AGCAGCAGCATGAATGGAGAGGG - Intronic
997098682 5:130943248-130943270 AGCAGCAGGAAGCAAAGAGCAGG + Intergenic
997451890 5:133990267-133990289 AGCAGCAGGAAGCTGGGAGAAGG + Intronic
998047781 5:139003271-139003293 AGCAACAGGTAGCAAGGGGCAGG + Intronic
999592063 5:153158925-153158947 AGCTCCAGCAAGCAGGAAGCTGG - Intergenic
999848545 5:155512410-155512432 TGCAGCAGGCAGCAAGGAGGAGG - Intergenic
1001030995 5:168262617-168262639 AGCAGCAGAAAGCCAGGGACGGG + Exonic
1002025396 5:176393174-176393196 AGAAGCAGCAAGCCAGGAACAGG - Intronic
1002078734 5:176725454-176725476 TGCAGGAGCCAGCAGGGAGCTGG + Intergenic
1002379172 5:178813194-178813216 AGCAGCAACAAGGATGGACCTGG + Intergenic
1003339403 6:5205213-5205235 TGCAGCAGGAAGAAAGGGGCAGG + Intronic
1004251440 6:14026235-14026257 AGCATCAGAAATCATGGAGCAGG + Intergenic
1005714987 6:28538559-28538581 AGCAGCAGCTAGAAAAGAACAGG - Intergenic
1005909698 6:30297680-30297702 TGCAGCAGCATGGATGGAGCTGG - Intergenic
1006265042 6:32913917-32913939 AGCAAAAGGAAGCAAGGATCTGG + Intergenic
1006508517 6:34507157-34507179 ATCAGCAGGAAGCAAAGAGCAGG + Intronic
1006718193 6:36133331-36133353 GGCAGCAGCAAGAAAGGAGTAGG + Intronic
1007085567 6:39142169-39142191 AGCAGTACCAAGCAAGATGCTGG + Intergenic
1007097462 6:39222336-39222358 AGCAGGAGAAAGGAAGGAGGGGG + Intronic
1007521375 6:42453308-42453330 AGCAGCTGCGAGCAGGGGGCAGG + Intergenic
1007989775 6:46243158-46243180 AGCTGCAACAATCAGGGAGCAGG - Intronic
1008097186 6:47351095-47351117 AGCAGAAGCAAGCAAGCGGGGGG + Intergenic
1008479728 6:51973047-51973069 AGAAGCAGAAAGCAAGCAGGTGG + Intronic
1009266055 6:61556093-61556115 AGTGGCAGCAACCAAGGTGCAGG + Intergenic
1009836562 6:69008704-69008726 TGCAGCAACAAGCAAGGAATGGG - Intronic
1010127789 6:72454049-72454071 TGCAGCAACATGGAAGGAGCTGG + Intergenic
1011116288 6:83896562-83896584 AGCAGCAACATGGAAGGAACTGG - Intronic
1011158001 6:84355301-84355323 AGCAGGAGCAAGCAAGAAAGAGG - Intergenic
1012169682 6:96002502-96002524 AGTGGCAGCAGGCAAGGTGCAGG + Intergenic
1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG + Exonic
1012752868 6:103184889-103184911 AGGAGCAGCCAGCAAGGAGCTGG + Intergenic
1013236731 6:108203311-108203333 AGTAGAGGCAAGCAGGGAGCTGG + Intergenic
1015390287 6:132674114-132674136 TGCAGTAGCATGGAAGGAGCTGG - Intergenic
1016558630 6:145369096-145369118 AGCAGCAGTGAGCAATGAGGTGG + Intergenic
1016751405 6:147634315-147634337 AGCAGAAGGAAGAAAGGAGGGGG + Intronic
1016819685 6:148335589-148335611 AACTGAAGCAAGAAAGGAGCAGG + Intronic
1017209416 6:151838335-151838357 AGCAGCAGGAAGAGAGGAGGTGG + Intronic
1017755500 6:157525842-157525864 AGCAGCTGGAAGCCAGTAGCTGG - Intronic
1017776446 6:157684716-157684738 TGCAGCAGCAAGCGAGGATGAGG + Intergenic
1018853340 6:167657415-167657437 AGCAGGAGGAAGAGAGGAGCAGG - Intergenic
1019125558 6:169838159-169838181 GGGAGCAGAAACCAAGGAGCAGG + Intergenic
1019938650 7:4272308-4272330 AGCACCAGCATGCACTGAGCGGG + Intergenic
1020784189 7:12554374-12554396 AGCAGCAAGAAGCAAACAGCTGG - Intergenic
1021383256 7:19994806-19994828 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1022250746 7:28605603-28605625 AATAGCAGGAAACAAGGAGCAGG - Intronic
1022311266 7:29198066-29198088 AGCAGCAGCAATGAGTGAGCTGG - Intronic
1022805672 7:33819835-33819857 AGCAGCAGCAAGCAAAAGCCAGG + Intergenic
1023780107 7:43647481-43647503 AGCAGGAGCAGGCTAGGAGGAGG + Intronic
1023890063 7:44385662-44385684 AACAACAGCAAGCAGAGAGCAGG + Exonic
1024274712 7:47668276-47668298 AGCAGTAGCAAGGAAAGGGCTGG + Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1026683625 7:72489631-72489653 AGCAGCAAAAAGAAAGGAGTGGG + Intergenic
1026735355 7:72945524-72945546 GGCAGAGGCAAGCGAGGAGCCGG - Intronic
1026830165 7:73605795-73605817 AGCAGCAGGCAGGGAGGAGCAGG + Intronic
1026895173 7:74006250-74006272 AGCAAAAGCAAGCTAAGAGCAGG + Intergenic
1027049761 7:75014679-75014701 ATCAGCAGCTGGCCAGGAGCAGG - Intronic
1027263265 7:76479833-76479855 ATCAGTAGCAAGAAAGAAGCTGG + Intronic
1027299256 7:76812729-76812751 TGCAGCAACATGCATGGAGCTGG - Intergenic
1027314645 7:76977938-76977960 ATCAGTAGCAAGAAAGAAGCTGG + Intergenic
1028665689 7:93341462-93341484 AGCAGAAGAAAGAAAGGAGAAGG + Exonic
1029383272 7:100226999-100227021 ATCAGCAGCTGGCCAGGAGCAGG + Intronic
1030013045 7:105190077-105190099 AGCAGGAGCAGGCCAGGAGCAGG + Intronic
1030487194 7:110184456-110184478 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1030593811 7:111511814-111511836 AGCAGGGCCCAGCAAGGAGCTGG + Intronic
1031093413 7:117390034-117390056 TGCAGCAGCACGCATGCAGCTGG - Intronic
1031294870 7:119988978-119989000 TGCAGCAACAAGTATGGAGCTGG + Intergenic
1034349460 7:150406711-150406733 AGAAGCAGCATGAAGGGAGCTGG + Intronic
1034580346 7:152035961-152035983 AGCAGAAGCAAGAAGAGAGCTGG - Intronic
1035094934 7:156346416-156346438 AGCAGAAGGAAGCAGGGAGAAGG + Intergenic
1035569131 8:660460-660482 AGCATCAGCCAGCAAGGACACGG + Intronic
1035597173 8:867250-867272 AGCTGCAAAAAGCAAAGAGCTGG - Intergenic
1037058734 8:14479584-14479606 AGCAGCAGCAAGAAAATTGCAGG - Intronic
1037138754 8:15495049-15495071 TGCAGCAGCAAAGATGGAGCTGG - Intronic
1037517856 8:19651560-19651582 TGCAGCAACAAGTATGGAGCTGG - Intronic
1039226119 8:35390126-35390148 AGGAGAAGCAAGGAAGGAGGAGG + Intronic
1039269184 8:35862276-35862298 ACCAGAAGGAAGGAAGGAGCTGG + Intergenic
1039719178 8:40143905-40143927 GGCAGCAGCAAGCCTGGAGGAGG - Intergenic
1039957142 8:42216324-42216346 AGGAGCAGGAGGCAGGGAGCTGG + Intergenic
1041278891 8:56191356-56191378 AGCAGGAGCAAGGAAGGAAGTGG + Intronic
1042399606 8:68330891-68330913 AGCAGCAGGAATCAGGGGGCGGG - Exonic
1044639306 8:94361653-94361675 AGCCACAACAAGCTAGGAGCTGG + Intergenic
1044694756 8:94911686-94911708 AGAAGCAGGAAGGAAGGAGATGG + Intronic
1044852799 8:96445612-96445634 AGCCGCAGGAAGCAAGAGGCGGG + Intergenic
1046025551 8:108718468-108718490 AACAGCAGAAAGCCAGCAGCTGG + Intronic
1046238954 8:111465042-111465064 AGCAGCAACATGGATGGAGCTGG + Intergenic
1046777145 8:118176509-118176531 TGCAGCAACATGCATGGAGCTGG + Intergenic
1047173864 8:122521918-122521940 AGCTACAGCAAGCAAAGAGGAGG + Intergenic
1047401481 8:124552168-124552190 GGCAGCAGCATGCATGGGGCTGG + Intronic
1047794431 8:128239698-128239720 AGCAGCAGCCATCAGGGAGTAGG + Intergenic
1048402354 8:134083697-134083719 AGCAGCAGCAGAGGAGGAGCAGG - Intergenic
1048572025 8:135664426-135664448 TGCAGCAGCCAGCAAGGTGCCGG - Intergenic
1049203696 8:141353693-141353715 AGGAGAAGGAAGCAAGCAGCCGG + Intergenic
1050029201 9:1367452-1367474 AGCAGGAGCAAGCAGGGCGGCGG + Intergenic
1051335320 9:16060615-16060637 AGCAGCACAAAGCAAGAAGGTGG - Intronic
1051487295 9:17622926-17622948 GGAAGAAGCAAGGAAGGAGCAGG - Intronic
1051494589 9:17705648-17705670 TGCAGCAACATGCATGGAGCTGG + Intronic
1052173157 9:25426610-25426632 AGGAGCAGCAAAAAAGGAGGAGG - Intergenic
1052577906 9:30313244-30313266 AGCAGGAGCAAGAGAGGAGTTGG + Intergenic
1053596498 9:39566992-39567014 AGCAGCAGGAAGGAAGGCTCCGG - Intergenic
1053619284 9:39799204-39799226 AGTGGCAGCAGGCAAGGTGCGGG + Intergenic
1053854463 9:42323632-42323654 AGCAGCAGGAAGGAAGGCTCTGG - Intergenic
1053877440 9:42558553-42558575 AGTGGCAGCAGGCAAGGTGCGGG + Intergenic
1053895222 9:42736135-42736157 AGTGGCAGCAGGCAAGGTGCGGG - Intergenic
1054234255 9:62543169-62543191 AGTGGCAGCAGGCAAGGTGCGGG - Intergenic
1054264873 9:62908225-62908247 AGTGGCAGCAGGCAAGGTGCGGG - Intergenic
1054569761 9:66798026-66798048 AGCAGCAGGAAGGAAGGCTCCGG + Intergenic
1054942072 9:70754142-70754164 GGCAGCAGCAGAAAAGGAGCTGG + Intronic
1055295957 9:74833861-74833883 AGCAGCAGAAAGTCAGGAGTTGG + Intronic
1055399237 9:75905659-75905681 AACAGCAGGAAGTAAGGGGCAGG + Intronic
1056795258 9:89654829-89654851 AGGAGCTGCAAGAAAGGAGTGGG - Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1057695434 9:97319624-97319646 CGCAGCAGCATGGATGGAGCTGG - Intronic
1058524137 9:105840251-105840273 AGCCTGAGAAAGCAAGGAGCTGG + Intergenic
1058551472 9:106120031-106120053 AGAAGCAGGAAGCAAGGGGGAGG - Intergenic
1058603182 9:106693188-106693210 AGCAGCAGGAAAGAAGGAGGAGG + Intergenic
1058896377 9:109404197-109404219 CGGAGCAGCAAGCAGGGATCAGG - Intronic
1058901311 9:109444796-109444818 AGTAGCACCAACCAAGCAGCAGG + Intronic
1060119224 9:120972572-120972594 AGCAGCAGCAACTAAGGATTTGG - Intronic
1060232231 9:121834210-121834232 TGCAGCAGCAGACAGGGAGCTGG - Intronic
1060727884 9:126017773-126017795 AGCACCAGCCAGCCAGGACCAGG - Intergenic
1061445808 9:130636538-130636560 AGCAGCAGGAAGCAGTGAGAGGG + Intronic
1061578657 9:131523439-131523461 TGCAGCAGTTAGCAAGGACCAGG - Exonic
1061719524 9:132543076-132543098 AGCGGCAGCCAGCAAGGTGCAGG - Intronic
1062493840 9:136822295-136822317 AGCAGAGGCAACCAAGGAGCAGG - Intronic
1185799577 X:2997743-2997765 AGCAGCAACATGGATGGAGCTGG - Intergenic
1185966013 X:4603892-4603914 CGCAGAAGCAGGCAGGGAGCTGG - Intergenic
1186842474 X:13497953-13497975 TGCAGCAACATGCATGGAGCTGG + Intergenic
1188011758 X:25063653-25063675 TGCAGCAACAAGGATGGAGCTGG + Intergenic
1188663645 X:32791242-32791264 AGGGGCAGCAAGCATGGTGCGGG - Intronic
1189198948 X:39175440-39175462 AGCAGCTGCAAGCAAGGGCAGGG - Intergenic
1189476268 X:41358616-41358638 AGCAGCAGCATTCAAGGACAAGG - Intronic
1189541237 X:41992498-41992520 AGCAACAGGTAGCTAGGAGCAGG - Intergenic
1189544987 X:42033512-42033534 AGCAGCAGCTAGCTGGGGGCAGG + Intergenic
1189921317 X:45905590-45905612 TGCAGCAACAAGGATGGAGCTGG - Intergenic
1190599748 X:52078245-52078267 ACAAGCAGAAAGCCAGGAGCAGG + Intergenic
1190608445 X:52169630-52169652 ACAAGCAGAAAGCCAGGAGCAGG - Intergenic
1192338984 X:70246599-70246621 TGCAGCAACATGCATGGAGCTGG + Intergenic
1193501942 X:82287602-82287624 TGCAGGAGCATGCATGGAGCTGG - Intergenic
1194551215 X:95301967-95301989 TGCAGCACCAAGGATGGAGCTGG + Intergenic
1195109966 X:101638253-101638275 AGAAGGAGCTAGCAAGGAGCGGG - Intergenic
1195576783 X:106460516-106460538 AGTAGCTGTATGCAAGGAGCAGG - Intergenic
1195770700 X:108347942-108347964 GGCAGCAGGAAACAAGCAGCAGG + Intronic
1196284921 X:113868356-113868378 ACCAGCAGCCAGCAAGGAAACGG + Intergenic
1197388239 X:125827048-125827070 AGCTGCAGCAGGCACTGAGCTGG - Intergenic
1198728911 X:139706407-139706429 TGCAGCAACATGCACGGAGCTGG + Intronic
1199351151 X:146802345-146802367 AGCAGGAGCAAGAGAGGAGGTGG - Intergenic
1199352756 X:146822148-146822170 AGCAGGAGCAAGAGAGGAGGTGG + Intergenic
1200167892 X:154049971-154049993 AGGAGCAGCAGGCAAGGAAGAGG + Intronic
1201345758 Y:12982858-12982880 AGCTGCAGCAGGCACAGAGCTGG - Intergenic