ID: 1012475795

View in Genome Browser
Species Human (GRCh38)
Location 6:99613803-99613825
Sequence TCCGGGGGGACGGAGAGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012475795_1012475803 3 Left 1012475795 6:99613803-99613825 CCTCTGCTCTCCGTCCCCCCGGA 0: 1
1: 0
2: 0
3: 16
4: 214
Right 1012475803 6:99613829-99613851 GGCGTCCGCCTTCAAGCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012475795 Original CRISPR TCCGGGGGGACGGAGAGCAG AGG (reversed) Exonic
901218844 1:7570752-7570774 TGGGGGGTGATGGAGAGCAGAGG - Intronic
903674343 1:25054809-25054831 GCTGGAGGGACGGAGAGGAGGGG + Intergenic
903907830 1:26697942-26697964 GGCCGGGGGACGGAGAGGAGCGG - Intronic
904205961 1:28855454-28855476 CGCTGGGGGACTGAGAGCAGGGG + Intronic
904604722 1:31692160-31692182 TCAGGGGAGACAGAGACCAGGGG - Intronic
904973834 1:34441071-34441093 TCAGGGAGGACGGAGAGCTTCGG - Intergenic
905894802 1:41538657-41538679 TTCTGGGTGACGAAGAGCAGAGG + Intronic
906323049 1:44828413-44828435 GCCTGGGGGACGGACAGGAGGGG + Exonic
906471097 1:46132199-46132221 GCTTGGGGGACGGAGAGCAGAGG + Exonic
907288449 1:53397052-53397074 TCGGGGGAGACAGAGAGCTGAGG + Intergenic
909905258 1:81186510-81186532 TCTGGGAGGATGGAGTGCAGAGG + Intergenic
910183187 1:84506776-84506798 GCCGGGCGGGCGGGGAGCAGGGG + Intergenic
915366927 1:155321909-155321931 ACTGGGGGCAAGGAGAGCAGGGG + Exonic
916098418 1:161372338-161372360 GCCCGGGGGATGGAGTGCAGTGG - Exonic
919844242 1:201631067-201631089 TCTGGGGGGACAGAGTGCCGGGG + Intronic
921217555 1:212950684-212950706 TCCGGGCGGCGGGAGAGCAGGGG - Exonic
922558095 1:226548587-226548609 TCAGGGCGGAGGGAAAGCAGTGG - Intergenic
922859539 1:228804484-228804506 TTTGGGGGTAAGGAGAGCAGTGG + Intergenic
1067669697 10:48307224-48307246 TCCGGGGCGGCGGGGAGCCGGGG + Intronic
1070812983 10:79307491-79307513 TCCGGGGGGTGGGAGAGCTGGGG - Exonic
1072638917 10:97196338-97196360 TCCCGGGGGAGGGAGCGCAAGGG + Intronic
1076338831 10:129728743-129728765 ACCAGGGGGACAGAGAACAGGGG - Intronic
1077018963 11:409101-409123 GCTGAGGGGACAGAGAGCAGTGG + Intronic
1077066743 11:644448-644470 TCTGGGGGGACGTTGAGAAGAGG - Exonic
1078063318 11:8061969-8061991 TCCTGGGGGAGCGAGAACAGAGG - Intronic
1078596600 11:12692613-12692635 TCCGTGGGCACTGAGAGTAGGGG + Intronic
1082561337 11:54624342-54624364 TCTGGGGGAAGGGACAGCAGGGG - Intergenic
1082614756 11:55344972-55344994 TCAGGGGGGAGGGATAGCATTGG + Intergenic
1084372393 11:68752196-68752218 TGCGGGTGGACAGAGGGCAGGGG + Intergenic
1085417211 11:76327478-76327500 TCCAGTGGTAGGGAGAGCAGGGG - Intergenic
1085950335 11:81322880-81322902 GGTGGGGGGACGGAGAGCATAGG + Intergenic
1087818429 11:102684544-102684566 TCAGGAGAGAGGGAGAGCAGGGG + Intergenic
1089178991 11:116567898-116567920 TTGGGGGTGAAGGAGAGCAGAGG - Intergenic
1090368272 11:126226547-126226569 GCCGGGGGGAAGGAGAGAAAAGG - Intronic
1091045038 11:132317872-132317894 TCCTGGGGGAGTGAGAGCAAGGG - Intronic
1091636136 12:2198295-2198317 TCCGGGGGGAGGCAGAGGCGGGG - Intronic
1095615930 12:44188466-44188488 TCCTGGGGGCCAGAGAGCAAAGG + Intronic
1096114359 12:49046627-49046649 CCCTTGGGGACGGTGAGCAGTGG + Exonic
1096694607 12:53340562-53340584 TCAGCGGGGCCGCAGAGCAGCGG - Intronic
1101434799 12:104655406-104655428 GCTGGGGGGAGTGAGAGCAGTGG - Intronic
1105432766 13:20352188-20352210 TACAGGAGGATGGAGAGCAGGGG - Intergenic
1106026507 13:25960428-25960450 TACAGAGGGAGGGAGAGCAGAGG - Intronic
1110731463 13:78883293-78883315 TTCCGGGGGAAGGACAGCAGGGG + Intergenic
1113769830 13:112900844-112900866 TCCCTGGGGACTGACAGCAGTGG + Intronic
1121380661 14:93463125-93463147 TCCAGGGGGAGGAAGAGCAGGGG + Intronic
1121885456 14:97538813-97538835 TCCTGGGGGACAGAGATGAGGGG - Intergenic
1122088828 14:99324728-99324750 ACCTGGGGGAGGGAGAGCACAGG + Intergenic
1122689341 14:103524301-103524323 GCCAGGGGGACACAGAGCAGTGG + Intergenic
1122839011 14:104445580-104445602 TCCTGGGGGACGGTGGGCTGGGG + Intergenic
1123226251 15:17035698-17035720 GGAGGGGGGACGGAGAGCATTGG - Intergenic
1125957575 15:43800806-43800828 TCGGGGCGGGCTGAGAGCAGAGG + Intronic
1127726142 15:61752052-61752074 TCTGAATGGACGGAGAGCAGAGG - Intergenic
1127964486 15:63913744-63913766 TCCAGGGGGATGGGCAGCAGGGG - Intronic
1131034821 15:89215237-89215259 GCCTGGAGGAAGGAGAGCAGAGG + Exonic
1131117171 15:89802680-89802702 CCCTGGGGGAGGGAGAGGAGCGG + Intronic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1132104236 15:99051308-99051330 GCCGGGGGGAGGGGGAGCAGGGG - Intergenic
1136169126 16:28477635-28477657 TCTGGGAGGGCAGAGAGCAGGGG + Exonic
1136392301 16:29973540-29973562 CGCGGGTGGACGGACAGCAGCGG - Intergenic
1136403040 16:30028839-30028861 GGCGGGGGGACGGGGAGGAGAGG - Intronic
1137584222 16:49654414-49654436 TCCTGGGGGGCGTAGAGCACAGG + Intronic
1137594501 16:49714855-49714877 TCCTGGGGGCTGGAGAGCAGGGG - Intronic
1138238530 16:55406883-55406905 TCAGGGAGGAAGGAGAGCTGGGG + Intronic
1138440757 16:57033722-57033744 TCCGAGGCAAGGGAGAGCAGGGG + Intronic
1138516225 16:57536621-57536643 CCCGGGGGGAGGGGAAGCAGGGG + Intergenic
1139534614 16:67563363-67563385 TCGGCGGAGACGGAGACCAGCGG - Intronic
1139960519 16:70714932-70714954 TCCAGTGGGACGGAGGGAAGTGG - Intronic
1140437914 16:74963593-74963615 GCCAGGGGGAGGGAGAGCATCGG + Intronic
1140693428 16:77507529-77507551 GCAGGGTGGAGGGAGAGCAGGGG + Intergenic
1141546467 16:84773407-84773429 TGCCAGGGGACGGAGAGAAGAGG - Intronic
1142090378 16:88206807-88206829 GCCGTGGGGACGGAGGGGAGGGG + Intergenic
1142090390 16:88206832-88206854 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090439 16:88206933-88206955 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090451 16:88206958-88206980 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090463 16:88206983-88207005 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090475 16:88207008-88207030 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090500 16:88207059-88207081 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090548 16:88207160-88207182 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090560 16:88207185-88207207 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090585 16:88207236-88207258 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090610 16:88207287-88207309 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090622 16:88207312-88207334 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090647 16:88207363-88207385 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142090659 16:88207388-88207410 GCCGCGGGGACGGAGGGGAGGGG + Intergenic
1142318660 16:89366782-89366804 TCCGGGGGCACCCAGGGCAGGGG + Intronic
1142757632 17:2025219-2025241 TCCGAGGGGGCGGAGAGGAGGGG - Exonic
1143174921 17:4950063-4950085 GCCGGCGGGGCGGGGAGCAGGGG + Intronic
1143515691 17:7418227-7418249 TCCAGGGGGAGGGAGAGGGGAGG - Exonic
1143789035 17:9278760-9278782 CACGGGGAGGCGGAGAGCAGGGG + Intronic
1144871957 17:18377351-18377373 TCCTGGGGGATTGAGAGCTGTGG + Intergenic
1145884538 17:28372836-28372858 GCCGGTGGGAAGGAGAGCTGTGG - Intronic
1147673939 17:42192389-42192411 TCCGGGAGGCCCTAGAGCAGGGG - Exonic
1148901904 17:50884807-50884829 TCCAGGAGGAAGGAAAGCAGGGG - Intergenic
1150388993 17:64780303-64780325 TCCGGGGGGAAGGGGCGCCGGGG - Intergenic
1150613104 17:66749283-66749305 TCCGGAGGGGTGGAGGGCAGGGG - Intronic
1151749337 17:76027715-76027737 TCCTGGGGGATTGAGAGCTGTGG - Intergenic
1152323496 17:79622444-79622466 ACCTGGGGGAGGGAGAGCAGTGG - Intergenic
1152559519 17:81070951-81070973 TGGGGGTGGAGGGAGAGCAGAGG - Intronic
1161421953 19:4180893-4180915 TCCGGGGGGTCGAAGATCTGTGG + Exonic
1161498230 19:4598770-4598792 GCCGGGGGGACTTAGAGAAGGGG - Intergenic
1163438053 19:17307140-17307162 GCCTGGGGGACAGAGCGCAGTGG - Intronic
1163821501 19:19498939-19498961 TCCAGGGGGACGGGCAGTAGTGG + Intronic
1164459840 19:28437414-28437436 TCAGAGGGGACAGTGAGCAGGGG - Intergenic
1165449659 19:35874671-35874693 ACCGTGGGGGCAGAGAGCAGAGG + Intronic
1165532906 19:36418737-36418759 TCCGGGTTCACGCAGAGCAGGGG - Intergenic
1166535733 19:43573466-43573488 TCCAGTGGGAGGGAGAGGAGTGG + Intronic
1166749484 19:45158231-45158253 GCCTGGGGAACGGAGAGCAAAGG - Intronic
1166788963 19:45386179-45386201 TCCTGGGGGACAGGGCGCAGAGG + Exonic
1167211245 19:48135535-48135557 CACGGGGTGACTGAGAGCAGAGG - Intronic
1167435021 19:49474337-49474359 TCCTGGGGCAGGGGGAGCAGAGG + Intronic
1167497909 19:49830189-49830211 TGCGGGGGGACGGGGGGCAGAGG - Exonic
1168154493 19:54465267-54465289 TCCAGGTGGAAGGACAGCAGCGG + Exonic
1168307397 19:55442898-55442920 TGCGGGGAGAACGAGAGCAGAGG + Intergenic
928907215 2:36381000-36381022 TCATGGGGCAGGGAGAGCAGCGG - Intronic
929555404 2:42922597-42922619 GCCGGGGGGATGGAGATGAGGGG - Intergenic
932111484 2:69005441-69005463 GCAGGGGGGAAGGATAGCAGTGG + Intergenic
934761045 2:96857481-96857503 TGCGCGGTGAAGGAGAGCAGTGG - Intronic
935015820 2:99181193-99181215 TCCGAAGGGAAGCAGAGCAGAGG - Exonic
936104948 2:109615240-109615262 TCCGCGGAGGAGGAGAGCAGCGG + Exonic
938416269 2:131105729-131105751 TCCGCGGGGCCGGAGAGGAGGGG - Intronic
943649117 2:190437781-190437803 TCTGTGGGGTGGGAGAGCAGAGG - Intronic
946516735 2:220420031-220420053 TCATGGGGAAGGGAGAGCAGAGG + Intergenic
946720217 2:222597797-222597819 TTGGGTGGGATGGAGAGCAGAGG - Intronic
947934042 2:233988142-233988164 TGCCGGGGGACAGAGAGCAGGGG - Intronic
948193196 2:236075923-236075945 TCCGCAGGGAGTGAGAGCAGGGG + Intronic
1168729163 20:61972-61994 TTCAGGGGAATGGAGAGCAGGGG - Intergenic
1170585026 20:17728147-17728169 TGGGGTGGGACGGGGAGCAGGGG - Intronic
1172426590 20:34860043-34860065 CTGGGGGGGCCGGAGAGCAGGGG + Intronic
1172468475 20:35174418-35174440 AACGGGGGGAGGGAGAGCCGAGG + Intronic
1172955626 20:38756125-38756147 TCAGGAGGGAAAGAGAGCAGAGG + Intronic
1173308391 20:41873312-41873334 TCCGAGGGGACAGAGAGCTGTGG + Intergenic
1175107549 20:56626038-56626060 TCTGGTGGGACTGAGACCAGAGG + Intergenic
1176457822 21:6928779-6928801 GCTCTGGGGACGGAGAGCAGAGG + Intergenic
1176835994 21:13793863-13793885 GCTCTGGGGACGGAGAGCAGAGG + Intergenic
1177074471 21:16554789-16554811 GCCGGGCGGACGGAGGGCGGTGG - Intergenic
1178351408 21:31874630-31874652 GCTGGGGGAACGGAGAGAAGGGG - Intronic
1179110512 21:38441673-38441695 TCCAGGGGGAGGGAGAGGAGTGG - Intronic
1179440985 21:41394009-41394031 ACAGTGGGGATGGAGAGCAGTGG - Intronic
1180108025 21:45632756-45632778 TCCAGTGGGACGCAGAGCAAGGG - Intergenic
1180206731 21:46265506-46265528 TCCAGGCGGAGGGAGAGGAGAGG - Exonic
1180400106 22:12409293-12409315 AGAGGGGGGACGGAGAGCATTGG - Intergenic
1181405518 22:22681800-22681822 ACCCTGGGGACAGAGAGCAGGGG - Intergenic
1181511624 22:23391861-23391883 TCCGTGGGGACGAGGGGCAGAGG + Intergenic
1181870266 22:25892617-25892639 TCCAGGGGAATGGAGATCAGGGG + Intronic
1181908395 22:26217996-26218018 TCCTGGGTGCTGGAGAGCAGAGG + Intronic
1183260883 22:36795131-36795153 TCCCGGGGGCCTGAGAGCACTGG - Intergenic
1183847566 22:40554785-40554807 TTCGGGGGTCTGGAGAGCAGTGG - Intronic
1184102279 22:42347206-42347228 TGTGGGGAGACGGAGAGAAGGGG - Intergenic
1185067983 22:48641529-48641551 TGCGAGGGGAGGGAGTGCAGTGG - Intronic
1185108317 22:48886618-48886640 TCAGGGGGCAGGGAGGGCAGGGG + Intergenic
953354675 3:42245561-42245583 TCCAGGGGGAGGGAGAGTAATGG + Intergenic
954371701 3:50172395-50172417 TCCAAGGGGAGGGAGAGCCGAGG - Intronic
955182084 3:56682463-56682485 TCCGCGGGGAGGGGCAGCAGGGG + Intronic
968231190 3:197005654-197005676 TCCAGGAGGAGGGAGAGCTGTGG + Intronic
968570303 4:1336840-1336862 TCCTGGAAGACAGAGAGCAGAGG - Exonic
968647807 4:1749011-1749033 GCGGTGGGGAGGGAGAGCAGTGG - Intergenic
968699291 4:2047122-2047144 TCCGTGGGGAGGAAGAACAGGGG - Intergenic
969106214 4:4808867-4808889 TCCTGGAGGAGGGAGAGAAGGGG + Intergenic
969271528 4:6106391-6106413 TCCTGGGGGGCAGTGAGCAGGGG + Intronic
969904698 4:10383209-10383231 TCCGGGGGGCTGGAGTACAGTGG - Intergenic
973792953 4:54395086-54395108 TCAGGGGAGGCTGAGAGCAGTGG + Intergenic
975699433 4:77048749-77048771 TCAGCGGGGACGGAAAGCACAGG - Intronic
977659256 4:99563792-99563814 TCCGGGGGAGAGGGGAGCAGTGG - Intronic
980835278 4:138184201-138184223 TCTGGTGGGACTTAGAGCAGTGG + Intronic
984682264 4:182624045-182624067 TCCAAGGGGCCTGAGAGCAGAGG - Intronic
984857323 4:184206149-184206171 TCCTGGGGGAAGGAGGGCGGAGG + Intronic
985515709 5:343710-343732 TGCGGGGTGCTGGAGAGCAGGGG + Intronic
985619124 5:944441-944463 GCAGGGAGCACGGAGAGCAGGGG - Intergenic
987160817 5:15140246-15140268 TCAGGAGGGAGGGAGAGGAGCGG + Intergenic
988254541 5:28804662-28804684 GCAGGGGGGACGGATAGCATTGG + Intergenic
990553603 5:56909158-56909180 TCTGGGGCCACGGAGAGAAGGGG + Intergenic
990977568 5:61572942-61572964 GCAGGGGTGACGGAGAGCACAGG + Intergenic
995872765 5:116759960-116759982 TCCGGAGGGACGCATAGCTGAGG - Intergenic
997254399 5:132417309-132417331 GCCGTGGGGATGGAGAGGAGTGG - Intronic
997355060 5:133257248-133257270 TAAGTGGGGAGGGAGAGCAGAGG + Intronic
999768594 5:154757787-154757809 GCAGGGGGGAAGGGGAGCAGGGG - Intronic
999768602 5:154757803-154757825 GCAGGGGGGAAGGGGAGCAGGGG - Intronic
999768610 5:154757819-154757841 GCAGGGGGGAAGGGGAGCAGGGG - Intronic
999768618 5:154757835-154757857 GCAGGGGGGAAGGGGAGCAGGGG - Intronic
1001388008 5:171355892-171355914 GGAGGGGGGAGGGAGAGCAGTGG - Intergenic
1001641288 5:173245868-173245890 TCCGGGAGGGTGGAGAGAAGGGG + Intergenic
1004565459 6:16791917-16791939 TCCTGGGGGATGGAGAGCACAGG - Intergenic
1004829968 6:19466077-19466099 TCCATGGGGACAGAGAGCACTGG - Intergenic
1006150048 6:31982232-31982254 TCAGGAGTGAGGGAGAGCAGGGG + Intronic
1006156349 6:32014970-32014992 TCAGGAGTGAGGGAGAGCAGGGG + Intronic
1007843899 6:44738487-44738509 TCCAGGAGGGCTGAGAGCAGAGG + Intergenic
1012475795 6:99613803-99613825 TCCGGGGGGACGGAGAGCAGAGG - Exonic
1015156434 6:130101621-130101643 GGCAGGGGGACTGAGAGCAGTGG + Intronic
1015512492 6:134052404-134052426 GCCGTGGAGACGGAGGGCAGCGG - Exonic
1019037324 6:169072593-169072615 TCCGGGGCTCCGGGGAGCAGAGG - Intergenic
1019051580 6:169187995-169188017 ACAGGGGGGACGGGGAGCGGGGG - Intergenic
1019167286 6:170107119-170107141 TCCTGGGGGACGGGCAGTAGAGG - Intergenic
1019540012 7:1547215-1547237 TCCGGGGAGCTGGAGTGCAGGGG - Intronic
1023418236 7:39951152-39951174 GCCGGGGGAACGGGGGGCAGCGG + Exonic
1026179715 7:68028211-68028233 TGCAGGGGGAGAGAGAGCAGAGG - Intergenic
1026366552 7:69654342-69654364 TCCAAGGGGAAGGAGAGCACAGG + Intronic
1027190307 7:75992556-75992578 TCCTGGGGGCCGGAGGGGAGAGG + Exonic
1028669806 7:93388356-93388378 TCCAGAGGGGCTGAGAGCAGTGG + Intergenic
1028706416 7:93852869-93852891 TCCTTGGGGAAGCAGAGCAGTGG + Intronic
1032068948 7:128792037-128792059 TCCGGGGGGACAGGGAGGAGAGG - Exonic
1032761541 7:134947708-134947730 TCCTGGAGGAGGAAGAGCAGAGG + Exonic
1034468779 7:151245102-151245124 TCCAGTGGGACTGAGGGCAGAGG - Intronic
1034695860 7:153052784-153052806 TGCGGGGGGACTGAGAGGAGAGG + Intergenic
1034904264 7:154929945-154929967 ACAGGGGGGACGGAGAGGCGAGG + Intronic
1034955027 7:155328760-155328782 TCTGGGGGGAGGGAGAGATGAGG - Intergenic
1035903252 8:3480320-3480342 TCCAGGGGGCTGGAGTGCAGTGG - Intronic
1038035438 8:23682767-23682789 TCCTGCGGGACGGCGCGCAGCGG - Exonic
1038642861 8:29341517-29341539 TCCTGAGGGAGGGAGAGGAGGGG - Intronic
1041185073 8:55290562-55290584 TGCAGGGGGAGGGAGAGCACTGG - Intronic
1043051277 8:75388790-75388812 TCCTGGAGGACACAGAGCAGGGG - Intergenic
1047992194 8:130297721-130297743 AGCGGGGGGGCGGGGAGCAGAGG + Intronic
1049193483 8:141302389-141302411 GTCGGGGGGAGGGAGGGCAGCGG - Intronic
1050368983 9:4901680-4901702 TCTGGGGGAAGGGGGAGCAGTGG - Intergenic
1052260461 9:26509510-26509532 TCCGGTGGGAGGGAAAGAAGAGG + Intergenic
1054356358 9:64067067-64067089 TCCGAGGAGAAGGAGAGCTGCGG - Intergenic
1055489179 9:76787384-76787406 TTCGGGGGGTGGGAGAACAGGGG + Intronic
1056754321 9:89372645-89372667 TCCTGGGGGACTGAGTGCATCGG - Intronic
1058396821 9:104563507-104563529 TCTGGGGGAAAGGAGAGAAGAGG - Intergenic
1058678959 9:107425143-107425165 TCCGCCGGGAAGGAGAGCTGGGG - Intergenic
1062122222 9:134839861-134839883 TCCTGTGGAACGGAGGGCAGGGG - Intronic
1062265730 9:135685715-135685737 GCCTGGGGGACGGTGAGCCGGGG + Intergenic
1185460760 X:331936-331958 GCCGAGGTGACGGGGAGCAGAGG - Intergenic
1185877252 X:3711716-3711738 TCCGGGGGGACCAAGACAAGGGG + Intronic
1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG + Intergenic
1189408233 X:40744851-40744873 TCCTGGGGGCTGGAGAACAGCGG + Intergenic
1190805460 X:53831969-53831991 TCAGGAGGGAGGGAGAGGAGTGG - Intergenic
1193798376 X:85905276-85905298 TCAGTGGAGACGGAGAGAAGAGG - Intronic
1196662865 X:118285950-118285972 TCCGCCAGGACGGAGTGCAGTGG - Intergenic
1198131301 X:133697919-133697941 TCAGAGGGGAAGGAGAGGAGGGG + Intronic
1198263955 X:134992190-134992212 TTCAGGGGGAAGGAGAGCTGAGG + Exonic
1202018710 Y:20440622-20440644 TCAGGCTGGATGGAGAGCAGTGG - Intergenic