ID: 1012476369

View in Genome Browser
Species Human (GRCh38)
Location 6:99618770-99618792
Sequence CAATAGCAACCCTGGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012476369_1012476377 17 Left 1012476369 6:99618770-99618792 CCTTGGAGCCAGGGTTGCTATTG No data
Right 1012476377 6:99618810-99618832 GCGAAAGAACCCCGGCCGCTTGG No data
1012476369_1012476375 9 Left 1012476369 6:99618770-99618792 CCTTGGAGCCAGGGTTGCTATTG No data
Right 1012476375 6:99618802-99618824 TGGCCGCGGCGAAAGAACCCCGG No data
1012476369_1012476383 30 Left 1012476369 6:99618770-99618792 CCTTGGAGCCAGGGTTGCTATTG No data
Right 1012476383 6:99618823-99618845 GGCCGCTTGGGCTAGTGCGGCGG No data
1012476369_1012476381 27 Left 1012476369 6:99618770-99618792 CCTTGGAGCCAGGGTTGCTATTG No data
Right 1012476381 6:99618820-99618842 CCCGGCCGCTTGGGCTAGTGCGG No data
1012476369_1012476378 18 Left 1012476369 6:99618770-99618792 CCTTGGAGCCAGGGTTGCTATTG No data
Right 1012476378 6:99618811-99618833 CGAAAGAACCCCGGCCGCTTGGG No data
1012476369_1012476374 -5 Left 1012476369 6:99618770-99618792 CCTTGGAGCCAGGGTTGCTATTG No data
Right 1012476374 6:99618788-99618810 TATTGGTGGCGAGCTGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012476369 Original CRISPR CAATAGCAACCCTGGCTCCA AGG (reversed) Intergenic
No off target data available for this crispr