ID: 1012483179

View in Genome Browser
Species Human (GRCh38)
Location 6:99690341-99690363
Sequence CTTTGTTTGCTCAAGGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012483179_1012483183 -5 Left 1012483179 6:99690341-99690363 CCTACAACCTTGAGCAAACAAAG No data
Right 1012483183 6:99690359-99690381 CAAAGATGGTAGCCAGGCAGTGG No data
1012483179_1012483187 11 Left 1012483179 6:99690341-99690363 CCTACAACCTTGAGCAAACAAAG No data
Right 1012483187 6:99690375-99690397 GCAGTGGTTGCCATGGGCCTTGG No data
1012483179_1012483185 5 Left 1012483179 6:99690341-99690363 CCTACAACCTTGAGCAAACAAAG No data
Right 1012483185 6:99690369-99690391 AGCCAGGCAGTGGTTGCCATGGG No data
1012483179_1012483188 12 Left 1012483179 6:99690341-99690363 CCTACAACCTTGAGCAAACAAAG No data
Right 1012483188 6:99690376-99690398 CAGTGGTTGCCATGGGCCTTGGG No data
1012483179_1012483184 4 Left 1012483179 6:99690341-99690363 CCTACAACCTTGAGCAAACAAAG No data
Right 1012483184 6:99690368-99690390 TAGCCAGGCAGTGGTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012483179 Original CRISPR CTTTGTTTGCTCAAGGTTGT AGG (reversed) Intergenic
No off target data available for this crispr