ID: 1012485942

View in Genome Browser
Species Human (GRCh38)
Location 6:99722665-99722687
Sequence AGATGTACAGTGCAAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012485942_1012485944 14 Left 1012485942 6:99722665-99722687 CCAACAATTTGCACTGTACATCT No data
Right 1012485944 6:99722702-99722724 CACTCAACATCAGCCCATGAAGG No data
1012485942_1012485945 26 Left 1012485942 6:99722665-99722687 CCAACAATTTGCACTGTACATCT No data
Right 1012485945 6:99722714-99722736 GCCCATGAAGGAGCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012485942 Original CRISPR AGATGTACAGTGCAAATTGT TGG (reversed) Intergenic
No off target data available for this crispr