ID: 1012487202

View in Genome Browser
Species Human (GRCh38)
Location 6:99735569-99735591
Sequence AGGCACACCATGCAGAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012487202_1012487205 21 Left 1012487202 6:99735569-99735591 CCCTAACTCTGCATGGTGTGCCT No data
Right 1012487205 6:99735613-99735635 ATCTTATCTTACCTTCAACTAGG No data
1012487202_1012487208 26 Left 1012487202 6:99735569-99735591 CCCTAACTCTGCATGGTGTGCCT No data
Right 1012487208 6:99735618-99735640 ATCTTACCTTCAACTAGGGTGGG No data
1012487202_1012487207 25 Left 1012487202 6:99735569-99735591 CCCTAACTCTGCATGGTGTGCCT No data
Right 1012487207 6:99735617-99735639 TATCTTACCTTCAACTAGGGTGG No data
1012487202_1012487206 22 Left 1012487202 6:99735569-99735591 CCCTAACTCTGCATGGTGTGCCT No data
Right 1012487206 6:99735614-99735636 TCTTATCTTACCTTCAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012487202 Original CRISPR AGGCACACCATGCAGAGTTA GGG (reversed) Intergenic
No off target data available for this crispr