ID: 1012487204

View in Genome Browser
Species Human (GRCh38)
Location 6:99735589-99735611
Sequence ATAAGAGAAACTCTACTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012487204_1012487207 5 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487207 6:99735617-99735639 TATCTTACCTTCAACTAGGGTGG No data
1012487204_1012487209 11 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487209 6:99735623-99735645 ACCTTCAACTAGGGTGGGAAAGG No data
1012487204_1012487212 13 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487212 6:99735625-99735647 CTTCAACTAGGGTGGGAAAGGGG No data
1012487204_1012487205 1 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487205 6:99735613-99735635 ATCTTATCTTACCTTCAACTAGG No data
1012487204_1012487211 12 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487211 6:99735624-99735646 CCTTCAACTAGGGTGGGAAAGGG No data
1012487204_1012487206 2 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487206 6:99735614-99735636 TCTTATCTTACCTTCAACTAGGG No data
1012487204_1012487208 6 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487208 6:99735618-99735640 ATCTTACCTTCAACTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012487204 Original CRISPR ATAAGAGAAACTCTACTCTG AGG (reversed) Intergenic
No off target data available for this crispr