ID: 1012487206

View in Genome Browser
Species Human (GRCh38)
Location 6:99735614-99735636
Sequence TCTTATCTTACCTTCAACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012487202_1012487206 22 Left 1012487202 6:99735569-99735591 CCCTAACTCTGCATGGTGTGCCT No data
Right 1012487206 6:99735614-99735636 TCTTATCTTACCTTCAACTAGGG No data
1012487203_1012487206 21 Left 1012487203 6:99735570-99735592 CCTAACTCTGCATGGTGTGCCTC No data
Right 1012487206 6:99735614-99735636 TCTTATCTTACCTTCAACTAGGG No data
1012487204_1012487206 2 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487206 6:99735614-99735636 TCTTATCTTACCTTCAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012487206 Original CRISPR TCTTATCTTACCTTCAACTA GGG Intergenic
No off target data available for this crispr