ID: 1012487208

View in Genome Browser
Species Human (GRCh38)
Location 6:99735618-99735640
Sequence ATCTTACCTTCAACTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012487204_1012487208 6 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487208 6:99735618-99735640 ATCTTACCTTCAACTAGGGTGGG No data
1012487202_1012487208 26 Left 1012487202 6:99735569-99735591 CCCTAACTCTGCATGGTGTGCCT No data
Right 1012487208 6:99735618-99735640 ATCTTACCTTCAACTAGGGTGGG No data
1012487203_1012487208 25 Left 1012487203 6:99735570-99735592 CCTAACTCTGCATGGTGTGCCTC No data
Right 1012487208 6:99735618-99735640 ATCTTACCTTCAACTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012487208 Original CRISPR ATCTTACCTTCAACTAGGGT GGG Intergenic
No off target data available for this crispr