ID: 1012487209

View in Genome Browser
Species Human (GRCh38)
Location 6:99735623-99735645
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012487203_1012487209 30 Left 1012487203 6:99735570-99735592 CCTAACTCTGCATGGTGTGCCTC No data
Right 1012487209 6:99735623-99735645 ACCTTCAACTAGGGTGGGAAAGG No data
1012487204_1012487209 11 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487209 6:99735623-99735645 ACCTTCAACTAGGGTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012487209 Original CRISPR ACCTTCAACTAGGGTGGGAA AGG Intergenic