ID: 1012487212

View in Genome Browser
Species Human (GRCh38)
Location 6:99735625-99735647
Sequence CTTCAACTAGGGTGGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012487204_1012487212 13 Left 1012487204 6:99735589-99735611 CCTCAGAGTAGAGTTTCTCTTAT No data
Right 1012487212 6:99735625-99735647 CTTCAACTAGGGTGGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012487212 Original CRISPR CTTCAACTAGGGTGGGAAAG GGG Intergenic
No off target data available for this crispr