ID: 1012491501

View in Genome Browser
Species Human (GRCh38)
Location 6:99787619-99787641
Sequence CAGGGCCTGGAGAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012491494_1012491501 24 Left 1012491494 6:99787572-99787594 CCAAGAATGGGATATGAGTCAAA No data
Right 1012491501 6:99787619-99787641 CAGGGCCTGGAGAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012491501 Original CRISPR CAGGGCCTGGAGAAGTGTCC AGG Intergenic
No off target data available for this crispr