ID: 1012492528

View in Genome Browser
Species Human (GRCh38)
Location 6:99798150-99798172
Sequence GCCTCGTCCTGAGCTGCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012492520_1012492528 19 Left 1012492520 6:99798108-99798130 CCATCTTCTCAGCTCAGGGAGAC No data
Right 1012492528 6:99798150-99798172 GCCTCGTCCTGAGCTGCGGTCGG No data
1012492526_1012492528 -6 Left 1012492526 6:99798133-99798155 CCGGGCTCTGTTTGGGAGCCTCG No data
Right 1012492528 6:99798150-99798172 GCCTCGTCCTGAGCTGCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012492528 Original CRISPR GCCTCGTCCTGAGCTGCGGT CGG Intergenic
No off target data available for this crispr