ID: 1012497494

View in Genome Browser
Species Human (GRCh38)
Location 6:99850130-99850152
Sequence ACTGCCTATAGGGGAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012497494_1012497503 1 Left 1012497494 6:99850130-99850152 CCCCCTTTTCCCCTATAGGCAGT No data
Right 1012497503 6:99850154-99850176 GGGATTTCACAGAACCTATAAGG No data
1012497494_1012497506 24 Left 1012497494 6:99850130-99850152 CCCCCTTTTCCCCTATAGGCAGT No data
Right 1012497506 6:99850177-99850199 AGGTCATTGACTTTTTTCCTTGG No data
1012497494_1012497504 4 Left 1012497494 6:99850130-99850152 CCCCCTTTTCCCCTATAGGCAGT No data
Right 1012497504 6:99850157-99850179 ATTTCACAGAACCTATAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012497494 Original CRISPR ACTGCCTATAGGGGAAAAGG GGG (reversed) Intergenic
No off target data available for this crispr