ID: 1012499581

View in Genome Browser
Species Human (GRCh38)
Location 6:99874228-99874250
Sequence TCTCACCATCCCTGAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012499581_1012499585 27 Left 1012499581 6:99874228-99874250 CCTGGCCCTCAGGGATGGTGAGA No data
Right 1012499585 6:99874278-99874300 TGAAGACAGCTCCTTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012499581 Original CRISPR TCTCACCATCCCTGAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr